Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 11273
  • Symbol: ATXN2L
  • Description: ataxin 2 like
DataSource: http://genomecrispr.dkfz.de/#!/results/ATXN2L

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
28826270 28826293 16 + 26472758 Jiyoye viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.25402270504236785 [135] [85] -2 hSpCas9 negative selection 12982
28826921 28826944 16 + 26472758 Jiyoye viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.7129460640158248 [362] [166] -5 hSpCas9 negative selection 12983
28829948 28829971 16 + 26472758 Jiyoye viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.6367679660817236 [199] [96] -4 hSpCas9 negative selection 12984
28826270 28826293 16 + 26472758 KBM7 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 0.40863698667568027 [701,858] [512,477] 4 hSpCas9 negative selection 204100
28826921 28826944 16 + 26472758 KBM7 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.3870972840560052 [1069,940] [409,316] -4 hSpCas9 negative selection 204101
28829948 28829971 16 + 26472758 KBM7 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.054291018299021054 [1091,953] [418,500] 0 hSpCas9 negative selection 204102
28826270 28826293 16 + 26472758 Raji viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.36005566186506394 [270] [48] -3 hSpCas9 negative selection 395218
28826921 28826944 16 + 26472758 Raji viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.4992740364468756 [401] [65] -4 hSpCas9 negative selection 395219
28829948 28829971 16 + 26472758 Raji viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.5043188132999779 [598] [48] -8 hSpCas9 negative selection 395220
28826270 28826293 16 + 26472758 K562 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 0.3245890763504301 [559] [591] 2 hSpCas9 negative selection 586336
28826921 28826944 16 + 26472758 K562 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.5944521464540016 [913] [510] -4 hSpCas9 negative selection 586337
28829948 28829971 16 + 26472758 K562 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.8654045502863045 [763] [353] -5 hSpCas9 negative selection 586338
28826247 28826270 16 + 26627737 DLD1 viability TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -0.9195575476646735 [462] [187,15,29] -7 hSpCas9 negative selection 793473
28826880 28826903 16 - 26627737 DLD1 viability CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.29399109784627997 [514] [221,165,201] 3 hSpCas9 negative selection 793474
28830043 28830066 16 - 26627737 DLD1 viability CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.3626124685036526 [792] [181,134,249] -4 hSpCas9 negative selection 793475
28826247 28826270 16 + 26627737 GBM cells viability after 5 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 0.05419210036359649 [263] [145,147] 0 hSpCas9 negative selection 875788
28826880 28826903 16 - 26627737 GBM cells viability after 5 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.5469285461421436 [290] [221,233] 7 hSpCas9 negative selection 875789
28830043 28830066 16 - 26627737 GBM cells viability after 5 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.6638750990622628 [295] [255,246] 8 hSpCas9 negative selection 875790
28826247 28826270 16 + 26627737 GBM cells viability after 13 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 0.9122833837172001 [263] [332,217] 9 hSpCas9 negative selection 958103
28826880 28826903 16 - 26627737 GBM cells viability after 13 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.777104675781672 [290] [242,292] 8 hSpCas9 negative selection 958104
28830043 28830066 16 - 26627737 GBM cells viability after 13 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.6912999671221165 [295] [303,222] 8 hSpCas9 negative selection 958105
28826247 28826270 16 + 26627737 GBM cells viability after 21 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 0.7664451188454672 [263] [267,221] 7 hSpCas9 negative selection 1040418
28826880 28826903 16 - 26627737 GBM cells viability after 21 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.9270058282541267 [290] [321,280] 8 hSpCas9 negative selection 1040419
28830043 28830066 16 - 26627737 GBM cells viability after 21 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.8974597137262544 [295] [309,289] 8 hSpCas9 negative selection 1040420
28826247 28826270 16 + 26627737 RPE1 viability after 9 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -3.465016141438386 [1393] [18,65] -9 hSpCas9 negative selection 1122733
28826880 28826903 16 - 26627737 RPE1 viability after 9 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.309750032840274 [1528] [722,425] 2 hSpCas9 negative selection 1122734
28830043 28830066 16 - 26627737 RPE1 viability after 9 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.7939127732713711 [1049] [441,734] 5 hSpCas9 negative selection 1122735
28826247 28826270 16 + 26627737 RPE1 viability after 12 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -3.661378163453698 [1393] [15,43] -9 hSpCas9 negative selection 1205048
28826880 28826903 16 - 26627737 RPE1 viability after 12 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.2823683870329283 [1528] [553,441] 2 hSpCas9 negative selection 1205049
28830043 28830066 16 - 26627737 RPE1 viability after 12 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.6833960293611745 [1049] [453,451] 4 hSpCas9 negative selection 1205050
28826247 28826270 16 + 26627737 RPE1 viability after 15 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -3.870435056126998 [1393] [0,51] -9 hSpCas9 negative selection 1287363
28826880 28826903 16 - 26627737 RPE1 viability after 15 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.7109540711769609 [1528] [764,652] 4 hSpCas9 negative selection 1287364
28830043 28830066 16 - 26627737 RPE1 viability after 15 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.44490932259263954 [1049] [470,339] 3 hSpCas9 negative selection 1287365
28826247 28826270 16 + 26627737 RPE1 viability after 18 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -4.239242033322892 [1393] [2,37] -9 hSpCas9 negative selection 1369678
28826880 28826903 16 - 26627737 RPE1 viability after 18 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.42418589167227694 [1528] [616,485] 2 hSpCas9 negative selection 1369679
28830043 28830066 16 - 26627737 RPE1 viability after 18 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.22583365659079385 [1049] [356,303] 1 hSpCas9 negative selection 1369680
28826247 28826270 16 + 26627737 HeLa viability after 8 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -0.5639426067755058 [721] [221,328,96] -5 hSpCas9 negative selection 1451993
28826880 28826903 16 - 26627737 HeLa viability after 8 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 1.1827156117711426 [208] [264,201,167] 8 hSpCas9 negative selection 1451994
28830043 28830066 16 - 26627737 HeLa viability after 8 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.19101152392990184 [639] [253,86,382] -2 hSpCas9 negative selection 1451995
28826247 28826270 16 + 26627737 HeLa viability after 12 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -2.0001537852016806 [721] [64,97,57] -9 hSpCas9 negative selection 1534308
28826880 28826903 16 - 26627737 HeLa viability after 12 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 2.076569946279043 [208] [600,343,156] 9 hSpCas9 negative selection 1534309
28830043 28830066 16 - 26627737 HeLa viability after 12 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.6098975340742091 [639] [577,384,254] 5 hSpCas9 negative selection 1534310
28826247 28826270 16 + 26627737 HeLa viability after 15 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -2.2759760910210516 [721] [0,94,88] -9 hSpCas9 negative selection 1616623
28826880 28826903 16 - 26627737 HeLa viability after 15 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.9433755725115732 [208] [148,178,162] 7 hSpCas9 negative selection 1616624
28830043 28830066 16 - 26627737 HeLa viability after 15 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.5715141560447036 [639] [486,349,317] 4 hSpCas9 negative selection 1616625
28826247 28826270 16 + 26627737 HeLa viability after 18 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -2.249347629613242 [721] [0,80,88] -9 hSpCas9 negative selection 1698938
28826880 28826903 16 - 26627737 HeLa viability after 18 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 1.0152289787293005 [208] [109,155,162] 7 hSpCas9 negative selection 1698939
28830043 28830066 16 - 26627737 HeLa viability after 18 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.576088078894257 [639] [328,289,317] 4 hSpCas9 negative selection 1698940
28826247 28826270 16 + 26627737 HCT116 viability after 6 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -0.9631834106181016 [568] [90,20] -5 hSpCas9 negative selection 1781253
28826880 28826903 16 - 26627737 HCT116 viability after 6 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 1.1530539197307823 [607] [53,299] 6 hSpCas9 negative selection 1781254
28830043 28830066 16 - 26627737 HCT116 viability after 6 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.9715496225027674 [1351] [177,69] -5 hSpCas9 negative selection 1781255
28826247 28826270 16 + 26627737 HCT116 viability after 8 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -1.0683829893192838 [314] [51,132,62] -8 hSpCas9 negative selection 1863568
28826880 28826903 16 - 26627737 HCT116 viability after 8 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.6644601737648256 [192] [199,117,187] 6 hSpCas9 negative selection 1863569
28830043 28830066 16 - 26627737 HCT116 viability after 8 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.015287908500410174 [530] [336,293,238] 0 hSpCas9 negative selection 1863570
28826247 28826270 16 + 26627737 HCT116 viability after 9 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -1.5907574325902267 [568] [112,0] -8 hSpCas9 negative selection 1945883
28826880 28826903 16 - 26627737 HCT116 viability after 9 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 -0.3973620537559974 [607] [53,177] -3 hSpCas9 negative selection 1945884
28830043 28830066 16 - 26627737 HCT116 viability after 9 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.03193956720922486 [1351] [186,512] 0 hSpCas9 negative selection 1945885
28826247 28826270 16 + 26627737 HCT116 viability after 12 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -3.1145110150385533 [314] [25,29,0] -9 hSpCas9 negative selection 2028198
28826880 28826903 16 - 26627737 HCT116 viability after 12 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.8489457675128576 [192] [217,142,182] 7 hSpCas9 negative selection 2028199
28830043 28830066 16 - 26627737 HCT116 viability after 12 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.47596964504044065 [530] [161,311,133] -5 hSpCas9 negative selection 2028200
28826247 28826270 16 + 26627737 HCT116 viability after 15 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -1.883214902328829 [314] [59,84,3] -9 hSpCas9 negative selection 2110513
28826880 28826903 16 - 26627737 HCT116 viability after 15 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.8320495015006055 [192] [247,142,206] 7 hSpCas9 negative selection 2110514
28830043 28830066 16 - 26627737 HCT116 viability after 15 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.359145776543217 [530] [148,278,273] -4 hSpCas9 negative selection 2110515
28826247 28826270 16 + 26627737 HCT116 viability after 18 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -2.288714299053804 [314] [57,32,0] -9 hSpCas9 negative selection 2192828
28826880 28826903 16 - 26627737 HCT116 viability after 18 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 1.0130439191318472 [192] [186,93,294] 7 hSpCas9 negative selection 2192829
28830043 28830066 16 - 26627737 HCT116 viability after 18 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.44578836610982675 [530] [148,233,178] -4 hSpCas9 negative selection 2192830
28829999 28830022 16 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity AGAAGCACAGTGCAGTCCAGCGG ATXN2L ENSG00000168488 0.22545459366590934 [2,3] [3,2] 5 hSpCas9 positive selection 2972619
28829949 28829972 16 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 0.7948620258919833 [2,2] [2,4] 9 hSpCas9 positive selection 2972620
28829999 28830022 16 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity AGAAGCACAGTGCAGTCCAGCGG ATXN2L ENSG00000168488 -1.3945611425756168 [2,2] [0,0] -9 hSpCas9 positive selection 3040477
28829949 28829972 16 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.011846570630483888 [2,2] [2,0] 0 hSpCas9 positive selection 3040478
28825665 28825688 - 24336571 A375 resistance to PLX after 7 days AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.11964478137109369 [57,61] [61,67] 4 hSpCas9 positive selection 3139627
28825820 28825843 + 24336571 A375 resistance to PLX after 7 days CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.2963448809941245 [40,49] [61,48] 7 hSpCas9 positive selection 3139638
28825665 28825688 - 24336571 A375 resistance to PLX after 14 days AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 3.8305041065863086 [50,50] [297,381] 9 hSpCas9 positive selection 3197420
28825820 28825843 + 24336571 A375 resistance to PLX after 14 days CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 1.979071458643027 [40,41] [80,71] 9 hSpCas9 positive selection 3197431
28825665 28825688 - 24336571 A375 viability after 7 days AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.13672201121603722 [56] [57,61] 2 hSpCas9 negative selection 3255213
28825820 28825843 + 24336571 A375 viability after 7 days CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 -0.03506751210382242 [48] [40,49] 0 hSpCas9 negative selection 3255224
28825665 28825688 - 24336571 A375 viability after 14 days AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.08800878969396742 [56] [50,50] -1 hSpCas9 negative selection 3313006
28825820 28825843 + 24336571 A375 viability after 14 days CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 -0.1536718023844701 [48] [40,41] -2 hSpCas9 negative selection 3313017
28826293 28826316 16 + 27383988 293T resistance to West Nile virus (flavivirus) CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.18484765667091485 [148,119] [0,0] 1 hSpCas9 positive selection 3338266
28825804 28825827 16 - 27383988 293T resistance to West Nile virus (flavivirus) CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 3.23742665400813 [96,113] [0,11] 8 hSpCas9 positive selection 3338267
28826294 28826317 16 - 27383988 293T resistance to West Nile virus (flavivirus) TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.7430182642884644 [77,104] [0,0] 3 hSpCas9 positive selection 3338268
28825820 28825843 16 + 27383988 293T resistance to West Nile virus (flavivirus) CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.15929412848530838 [136,136] [0,0] 0 hSpCas9 positive selection 3357523
28825665 28825688 16 - 27383988 293T resistance to West Nile virus (flavivirus) AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.4841407749553118 [213,213] [0,0] -3 hSpCas9 positive selection 3357524
28825391 28825414 16 - 27383988 293T resistance to West Nile virus (flavivirus) AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 1.2349583984173806 [64,64] [0,0] 5 hSpCas9 positive selection 3357525
28829998 28830021 16 + 26780180 HT29 viability (Avana library 4 designs) AGAAGCACAGTGCAGTCCAGCGG ATXN2L ENSG00000168488 3.56746113694139 [] [] 9 hSpCas9 negative selection 3408774
28829948 28829971 16 + 26780180 HT29 viability (Avana library 4 designs) GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 2.85761757181338 [] [] 8 hSpCas9 negative selection 3408775
28829998 28830021 16 + 26780180 A375 viability (Avana lentiCRISPRv2) AGAAGCACAGTGCAGTCCAGCGG ATXN2L ENSG00000168488 -3.32556570869054 [] [] -4 hSpCas9 negative selection 3482476
28829948 28829971 16 + 26780180 A375 viability (Avana lentiCRISPRv2) GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -9.44892997550225 [] [] -7 hSpCas9 negative selection 3482477
28829998 28830021 16 + 26780180 A375 viability (Avana lentiGuide) AGAAGCACAGTGCAGTCCAGCGG ATXN2L ENSG00000168488 8.91080774609885 [] [] 6 hSpCas9 negative selection 3591135
28829948 28829971 16 + 26780180 A375 viability (Avana lentiGuide) GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 4.35439205640549 [] [] 4 hSpCas9 negative selection 3591136
28829998 28830021 16 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AGAAGCACAGTGCAGTCCAGCGG ATXN2L ENSG00000168488 -0.2810428721366821 [4] [3,3] -4 hSpCas9 positive selection 3699794
28829948 28829971 16 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.45845528565884275 [3] [2,2] -6 hSpCas9 positive selection 3699795
28829998 28830021 16 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AGAAGCACAGTGCAGTCCAGCGG ATXN2L ENSG00000168488 -2.344104950929277 [5] [0,0] -9 hSpCas9 positive selection 3808401
28829948 28829971 16 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.315793407173763 [4] [0,0] -9 hSpCas9 positive selection 3808402
28825665 28825688 16 - 26780180 A375 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.912482835671881 [] [] 4 hSpCas9 negative selection 3916655
28825391 28825414 16 - 26780180 A375 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 1.03854986588124 [] [] 5 hSpCas9 negative selection 3916656
28826293 28826316 16 + 26780180 A375 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 1.80293642180435 [] [] 9 hSpCas9 negative selection 3916657
28825820 28825843 16 + 26780180 A375 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.674008045841233 [] [] 2 hSpCas9 negative selection 3916658
28825804 28825827 16 - 26780180 A375 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 1.55744920370292 [] [] 8 hSpCas9 negative selection 3916659
28826294 28826317 16 - 26780180 A375 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 1.03617516593222 [] [] 5 hSpCas9 negative selection 3916660
28825665 28825688 16 - 26780180 HT29 viability (GeCKOv2 library) AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 1.28641127604862 [] [] 6 hSpCas9 negative selection 4024621
28825391 28825414 16 - 26780180 HT29 viability (GeCKOv2 library) AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 1.17108611225437 [] [] 5 hSpCas9 negative selection 4024622
28826293 28826316 16 + 26780180 HT29 viability (GeCKOv2 library) CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 1.42461662570415 [] [] 7 hSpCas9 negative selection 4024623
28825820 28825843 16 + 26780180 HT29 viability (GeCKOv2 library) CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 1.17898128349147 [] [] 6 hSpCas9 negative selection 4024624
28825804 28825827 16 - 26780180 HT29 viability (GeCKOv2 library) CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 1.86830502406075 [] [] 8 hSpCas9 negative selection 4024625
28826294 28826317 16 - 26780180 HT29 viability (GeCKOv2 library) TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 1.44509726027752 [] [] 7 hSpCas9 negative selection 4024626
28825665 28825688 16 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.8014527952033617 [5] [5,8] 9 hSpCas9 positive selection 4164981
28825820 28825843 16 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.3832761902316648 [5] [3,6] 8 hSpCas9 positive selection 4164992
28825665 28825688 16 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.9555262620578051 [6] [5,4,5,4] 6 hSpCas9 positive selection 4229003
28825820 28825843 16 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.8232615573711412 [5] [4,6,3,3] 5 hSpCas9 positive selection 4229014
28826293 28826316 16 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.4001075209016387 [3] [2,0] -7 hSpCas9 positive selection 4257541
28825804 28825827 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.5988365627502316 [2] [2,0] -8 hSpCas9 positive selection 4257542
28826294 28826317 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.15676026017540026 [2] [2,1] -3 hSpCas9 positive selection 4257543
28825820 28825843 16 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.35059250643115836 [2] [3,1] 7 hSpCas9 positive selection 4321825
28825665 28825688 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.08731564806306721 [3] [3,1] 1 hSpCas9 positive selection 4321826
28825391 28825414 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.21279026711472782 [2] [1,0] -4 hSpCas9 positive selection 4321827
28826234 28826256 16 + 27760321 OCIAML3 viability TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 0.4519849113532348 [444,355] [349,524] 5 hSpCas9 negative selection 4380841
28826971 28826993 16 - 27760321 OCIAML3 viability CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 0.13132555939595983 [575,459] [398,495] 1 hSpCas9 negative selection 4380842
28829397 28829419 16 - 27760321 OCIAML3 viability GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 0.5209949174121081 [445,348] [390,510] 6 hSpCas9 negative selection 4380843
28829949 28829971 16 + 27760321 OCIAML3 viability TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.7961961922760565 [1089,976] [348,615] -6 hSpCas9 negative selection 4380844
28826234 28826256 16 + 27760321 OCIAML2 viability TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 0.1662035385553213 [444,355] [319,415] 2 hSpCas9 negative selection 4464304
28826971 28826993 16 - 27760321 OCIAML2 viability CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 0.3135236014382855 [575,459] [417,648] 4 hSpCas9 negative selection 4464305
28829397 28829419 16 - 27760321 OCIAML2 viability GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 0.02169085234102358 [445,348] [268,396] 0 hSpCas9 negative selection 4464306
28829949 28829971 16 + 27760321 OCIAML2 viability TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.71861406257783 [1089,976] [462,565] -6 hSpCas9 negative selection 4464307
28826234 28826256 16 + 27760321 MV411 viability TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 0.24136561162594417 [444,355] [65,677] 1 hSpCas9 negative selection 4547767
28826971 28826993 16 - 27760321 MV411 viability CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.6915367119685394 [575,459] [219,195] -5 hSpCas9 negative selection 4547768
28829397 28829419 16 - 27760321 MV411 viability GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 0.6362896919756404 [445,348] [129,817] 5 hSpCas9 negative selection 4547769
28829949 28829971 16 + 27760321 MV411 viability TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.7280449998440014 [1089,976] [226,687] -5 hSpCas9 negative selection 4547770
28826234 28826256 16 + 27760321 HL60 viability TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 0.0904965331949793 [444,355] [372,317] 1 hSpCas9 negative selection 4631230
28826971 28826993 16 - 27760321 HL60 viability CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 0.021597499278892845 [575,459] [293,567] 0 hSpCas9 negative selection 4631231
28829397 28829419 16 - 27760321 HL60 viability GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -0.09443371033096126 [445,348] [304,298] -1 hSpCas9 negative selection 4631232
28829949 28829971 16 + 27760321 HL60 viability TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.49418115934813167 [1089,976] [603,592] -5 hSpCas9 negative selection 4631233
28826234 28826256 16 + 27760321 HT1080 viability TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.4745458854154049 [355,277] [77,104] -2 hSpCas9 negative selection 4714693
28826971 28826993 16 - 27760321 HT1080 viability CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.335791322283427 [459,358] [81,180] -1 hSpCas9 negative selection 4714694
28829397 28829419 16 - 27760321 HT1080 viability GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 1.3521826791724503 [348,272] [312,319] 7 hSpCas9 negative selection 4714695
28829949 28829971 16 + 27760321 HT1080 viability TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.3409336221041769 [976,762] [202,350] -1 hSpCas9 negative selection 4714696
28826234 28826256 16 + 27760321 HT29 viability after 7 days TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.17632911552802696 [355,277] [307,403,361] -3 hSpCas9 negative selection 4798156
28826971 28826993 16 - 27760321 HT29 viability after 7 days CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 0.02871439895461389 [459,358] [509,730,370] 0 hSpCas9 negative selection 4798157
28829397 28829419 16 - 27760321 HT29 viability after 7 days GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 0.010246261257162936 [348,272] [442,448,323] 0 hSpCas9 negative selection 4798158
28829949 28829971 16 + 27760321 HT29 viability after 7 days TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.05286081885235849 [976,762] [1067,1178,987] -1 hSpCas9 negative selection 4798159
28826234 28826256 16 + 27760321 HT29 viability after 25 days TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -1.3030278081463431 [355,277] [76,191,178] -7 hSpCas9 negative selection 4881619
28826971 28826993 16 - 27760321 HT29 viability after 25 days CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.43034909467283694 [459,358] [282,357,410] -4 hSpCas9 negative selection 4881620
28829397 28829419 16 - 27760321 HT29 viability after 25 days GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -1.2402487051529725 [348,272] [37,228,195] -7 hSpCas9 negative selection 4881621
28829949 28829971 16 + 27760321 HT29 viability after 25 days TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.7191396657040592 [976,762] [286,312,306] -7 hSpCas9 negative selection 4881622
28826234 28826256 16 + 27760321 HT29 viability after 22 days TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.7998752987026243 [355,277] [208,164,257] -6 hSpCas9 negative selection 4965082
28826971 28826993 16 - 27760321 HT29 viability after 22 days CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.5584525302418138 [459,358] [286,385,291] -5 hSpCas9 negative selection 4965083
28829397 28829419 16 - 27760321 HT29 viability after 22 days GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -0.9860894305111316 [348,272] [265,126,148] -6 hSpCas9 negative selection 4965084
28829949 28829971 16 + 27760321 HT29 viability after 22 days TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.4365414997242212 [976,762] [430,327,353] -7 hSpCas9 negative selection 4965085
28826234 28826256 16 + 27760321 HT29 viability after 19 days TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.4876199169099018 [355,277] [256,168,345] -4 hSpCas9 negative selection 5048545
28826971 28826993 16 - 27760321 HT29 viability after 19 days CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.5494562374621348 [459,358] [383,436,151] -5 hSpCas9 negative selection 5048546
28829397 28829419 16 - 27760321 HT29 viability after 19 days GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -0.5582279221271567 [348,272] [229,401,96] -5 hSpCas9 negative selection 5048547
28829949 28829971 16 + 27760321 HT29 viability after 19 days TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.562426917620556 [976,762] [292,743,933] -5 hSpCas9 negative selection 5048548
28826234 28826256 16 + 27760321 HT29 viability after 16 days TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.27404321911918106 [355,277] [111,360,387] -3 hSpCas9 negative selection 5132008
28826971 28826993 16 - 27760321 HT29 viability after 16 days CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.9526331791582018 [459,358] [166,218,317] -7 hSpCas9 negative selection 5132009
28829397 28829419 16 - 27760321 HT29 viability after 16 days GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -0.44684246410618894 [348,272] [386,190,201] -4 hSpCas9 negative selection 5132010
28829949 28829971 16 + 27760321 HT29 viability after 16 days TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.0751659935643965 [976,762] [244,438,681] -7 hSpCas9 negative selection 5132011
28826234 28826256 16 + 27760321 HT29 viability after 13 days TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.7975563185055682 [355,277] [158,249,224] -7 hSpCas9 negative selection 5215471
28826971 28826993 16 - 27760321 HT29 viability after 13 days CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.25451479068062655 [459,358] [305,288,587] -3 hSpCas9 negative selection 5215472
28829397 28829419 16 - 27760321 HT29 viability after 13 days GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -0.027766030039284906 [348,272] [297,546,224] 0 hSpCas9 negative selection 5215473
28829949 28829971 16 + 27760321 HT29 viability after 13 days TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.7164750527611978 [976,762] [562,617,658] -6 hSpCas9 negative selection 5215474
28826234 28826256 16 + 27760321 HT29 viability after 10 days TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.2596686292840473 [355,277] [391,427,177] -3 hSpCas9 negative selection 5298934
28826971 28826993 16 - 27760321 HT29 viability after 10 days CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -0.22223375430941963 [459,358] [516,346,447] -3 hSpCas9 negative selection 5298935
28829397 28829419 16 - 27760321 HT29 viability after 10 days GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -0.169743466612098 [348,272] [377,396,263] -2 hSpCas9 negative selection 5298936
28829949 28829971 16 + 27760321 HT29 viability after 10 days TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.1873028693167358 [976,762] [578,942,1330] -2 hSpCas9 negative selection 5298937
28826234 28826256 16 + 27760321 MOLM13 viability TTGTAGTTTGAACTAGCCGTGG ATXN2L ENSG00000168488 -0.6404466677147697 [444,355] [108,173] -4 hSpCas9 negative selection 5382397
28826971 28826993 16 - 27760321 MOLM13 viability CTATACCATGTCAGACTCGAGG ATXN2L ENSG00000168488 -1.540466430506946 [575,459] [114,86] -7 hSpCas9 negative selection 5382398
28829397 28829419 16 - 27760321 MOLM13 viability GGGGTCCCATCCATTGGACTGG ATXN2L ENSG00000168488 -1.9368120536131057 [445,348] [48,65] -8 hSpCas9 negative selection 5382399
28829949 28829971 16 + 27760321 MOLM13 viability TACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.8945358363494311 [1089,976] [174,430] -5 hSpCas9 negative selection 5382400
28826293 28826316 16 + 27260156 BXPC3 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.31199893872053397 [467] [623,505,613,696] 6 hSpCas9 negative selection 5530001
28825804 28825827 16 - 27260156 BXPC3 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.6570852037674471 [453] [706,805,723,752] 9 hSpCas9 negative selection 5530002
28826294 28826317 16 - 27260156 BXPC3 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.5313524695572608 [323] [419,450,490,618] 9 hSpCas9 negative selection 5530003
28825820 28825843 16 + 27260156 BXPC3 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.03483048683112766 [294] [278,312,289,392] 0 hSpCas9 negative selection 5594285
28825665 28825688 16 - 27260156 BXPC3 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.4800955472021799 [482] [754,615,678,769] 8 hSpCas9 negative selection 5594286
28825391 28825414 16 - 27260156 BXPC3 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.38608359212926635 [208] [308,228,339,260] 8 hSpCas9 negative selection 5594287
28826293 28826316 16 + 27260156 A673 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.13280623434382133 [467] [630,505,698,631] 3 hSpCas9 negative selection 5651252
28825804 28825827 16 - 27260156 A673 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.1536841689569297 [453] [639,580,586,621] 3 hSpCas9 negative selection 5651253
28826294 28826317 16 - 27260156 A673 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.21656436415407587 [323] [497,461,455,392] 5 hSpCas9 negative selection 5651254
28825820 28825843 16 + 27260156 A673 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.431584510065412 [294] [490,381,463,582] 8 hSpCas9 negative selection 5715536
28825665 28825688 16 - 27260156 A673 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.11309851164718013 [482] [667,474,720,652] 2 hSpCas9 negative selection 5715537
28825391 28825414 16 - 27260156 A673 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.004303402926076227 [208] [245,255,244,258] 0 hSpCas9 negative selection 5715538
28826293 28826316 16 + 27260156 A375 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.7156106283073483 [467] [381,354,322,279] -7 hSpCas9 negative selection 5772503
28825804 28825827 16 - 27260156 A375 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -1.1986602468106233 [453] [307,285,194,151] -8 hSpCas9 negative selection 5772504
28826294 28826317 16 - 27260156 A375 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.663402706399719 [323] [199,243,417,108] -7 hSpCas9 negative selection 5772505
28825820 28825843 16 + 27260156 A375 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.36640392695841617 [294] [312,552,495,428] 5 hSpCas9 negative selection 5836787
28825665 28825688 16 - 27260156 A375 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.1755872190974067 [482] [841,809,525,419] 2 hSpCas9 negative selection 5836788
28825391 28825414 16 - 27260156 A375 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.7398570550372101 [208] [143,199,95,150] -7 hSpCas9 negative selection 5836789
28826293 28826316 16 + 27260156 COLO741 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.09495861250578845 [467] [587,550,542] -2 hSpCas9 negative selection 5893754
28825804 28825827 16 - 27260156 COLO741 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.2284530504225434 [453] [557,401,526] -5 hSpCas9 negative selection 5893755
28826294 28826317 16 - 27260156 COLO741 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.09925161007663608 [323] [672,393,292] 2 hSpCas9 negative selection 5893756
28825820 28825843 16 + 27260156 COLO741 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.25031251157185147 [294] [461,418,462] 5 hSpCas9 negative selection 5958038
28825665 28825688 16 - 27260156 COLO741 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.12605089928960442 [482] [740,602,679] 2 hSpCas9 negative selection 5958039
28825391 28825414 16 - 27260156 COLO741 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.12007593873274813 [208] [285,264,192] -3 hSpCas9 negative selection 5958040
28826293 28826316 16 + 27260156 CAL120 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.4431884756721628 [467] [1342,546,571] 6 hSpCas9 negative selection 6015005
28825804 28825827 16 - 27260156 CAL120 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.05557712578635589 [453] [645,590,533] 0 hSpCas9 negative selection 6015006
28826294 28826317 16 - 27260156 CAL120 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.5964554025340616 [323] [253,335,208] -7 hSpCas9 negative selection 6015007
28825820 28825843 16 + 27260156 CAL120 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.2009644029910016 [294] [310,570,367] 3 hSpCas9 negative selection 6079289
28825665 28825688 16 - 27260156 CAL120 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.3748688379274989 [482] [705,797,821] 5 hSpCas9 negative selection 6079290
28825391 28825414 16 - 27260156 CAL120 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.5461345911238316 [208] [242,409,463] 7 hSpCas9 negative selection 6079291
28826293 28826316 16 + 27260156 CADOES1 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.4345666037864588 [467] [593,686,541,527] 7 hSpCas9 negative selection 6136256
28825804 28825827 16 - 27260156 CADOES1 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.09877389006578038 [453] [369,481,502,453] 1 hSpCas9 negative selection 6136257
28826294 28826317 16 - 27260156 CADOES1 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.51164069225818 [323] [231,174,209,228] -7 hSpCas9 negative selection 6136258
28825820 28825843 16 + 27260156 CADOES1 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 -0.11761705527131028 [294] [227,257,211,315] -2 hSpCas9 negative selection 6200540
28825665 28825688 16 - 27260156 CADOES1 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.2550955651981333 [482] [653,549,382,557] 4 hSpCas9 negative selection 6200541
28825391 28825414 16 - 27260156 CADOES1 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.5835306831724656 [208] [138,167,105,104] -8 hSpCas9 negative selection 6200542
28826293 28826316 16 + 27260156 EWS502 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.16705968665170584 [467] [585,682,450,488] 3 hSpCas9 negative selection 6257507
28825804 28825827 16 - 27260156 EWS502 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.4681405035651152 [453] [369,224,350,452] -7 hSpCas9 negative selection 6257508
28826294 28826317 16 - 27260156 EWS502 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.1035375049011652 [323] [271,325,292,395] -2 hSpCas9 negative selection 6257509
28825820 28825843 16 + 27260156 EWS502 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.2831476798955906 [294] [358,442,316,400] 5 hSpCas9 negative selection 6321791
28825665 28825688 16 - 27260156 EWS502 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.081695571474628 [482] [387,471,625,457] -1 hSpCas9 negative selection 6321792
28825391 28825414 16 - 27260156 EWS502 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.11360391703004824 [208] [174,166,192,293] -2 hSpCas9 negative selection 6321793
28826293 28826316 16 + 27260156 EW8 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.17252239653199095 [467] [428,451,354,484] 3 hSpCas9 negative selection 6378758
28825804 28825827 16 - 27260156 EW8 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.23828157046969342 [453] [309,245,263,433] -4 hSpCas9 negative selection 6378759
28826294 28826317 16 - 27260156 EW8 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.07838173861063946 [323] [241,305,198,254] -1 hSpCas9 negative selection 6378760
28825820 28825843 16 + 27260156 EW8 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.26707644478419695 [294] [197,427,250,269] 5 hSpCas9 negative selection 6443042
28825665 28825688 16 - 27260156 EW8 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.29365438975317953 [482] [658,397,463,418] 5 hSpCas9 negative selection 6443043
28825391 28825414 16 - 27260156 EW8 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.12231871476155276 [208] [127,255,136,217] 2 hSpCas9 negative selection 6443044
28826293 28826316 16 + 27260156 CORL105 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.34464139378320374 [467] [677,608,793,717] 6 hSpCas9 negative selection 6500009
28825804 28825827 16 - 27260156 CORL105 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.017833947769689835 [453] [522,484,604,499] 0 hSpCas9 negative selection 6500010
28826294 28826317 16 - 27260156 CORL105 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.13844631215129227 [323] [401,227,584,483] 2 hSpCas9 negative selection 6500011
28825820 28825843 16 + 27260156 CORL105 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.24525332588590354 [294] [379,427,522,322] 4 hSpCas9 negative selection 6564293
28825665 28825688 16 - 27260156 CORL105 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.43450502713018513 [482] [408,454,458,355] -7 hSpCas9 negative selection 6564294
28825391 28825414 16 - 27260156 CORL105 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.12664779639449497 [208] [144,263,225,257] -2 hSpCas9 negative selection 6564295
28826293 28826316 16 + 27260156 HS294T viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.1439511470980094 [467] [236,179,169,210] 2 hSpCas9 negative selection 6621260
28825804 28825827 16 - 27260156 HS294T viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.3183469328411152 [453] [92,87,227,163] -4 hSpCas9 negative selection 6621261
28826294 28826317 16 - 27260156 HS294T viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.043446975645786534 [323] [96,73,90,284] 0 hSpCas9 negative selection 6621262
28825820 28825843 16 + 27260156 HS294T viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.8108297911815068 [294] [289,172,107,224] 9 hSpCas9 negative selection 6685544
28825665 28825688 16 - 27260156 HS294T viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.0927710444149204 [482] [245,165,183,195] 1 hSpCas9 negative selection 6685545
28825391 28825414 16 - 27260156 HS294T viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.7796949075844335 [208] [28,28,82,49] -8 hSpCas9 negative selection 6685546
28826293 28826316 16 + 27260156 HCC44 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.15433366575100713 [467] [661,538,655,521] 2 hSpCas9 negative selection 6742511
28825804 28825827 16 - 27260156 HCC44 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.5600865126568887 [453] [877,746,1013,449] 8 hSpCas9 negative selection 6742512
28826294 28826317 16 - 27260156 HCC44 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.6208881422727143 [323] [598,462,851,407] 8 hSpCas9 negative selection 6742513
28825820 28825843 16 + 27260156 HCC44 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 -0.032825049439859755 [294] [308,235,589,226] 0 hSpCas9 negative selection 6806795
28825665 28825688 16 - 27260156 HCC44 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.6449004610104123 [482] [1081,541,1037,844] 9 hSpCas9 negative selection 6806796
28825391 28825414 16 - 27260156 HCC44 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.3160440045678051 [208] [356,153,413,295] 5 hSpCas9 negative selection 6806797
28826293 28826316 16 + 27260156 G402 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.07888335438507367 [467] [305,503,740,571] -1 hSpCas9 negative selection 6863762
28825804 28825827 16 - 27260156 G402 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.9419255668052167 [453] [331,119,220,466] -8 hSpCas9 negative selection 6863763
28826294 28826317 16 - 27260156 G402 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -1.0774136174210955 [323] [217,223,184,130] -8 hSpCas9 negative selection 6863764
28825820 28825843 16 + 27260156 G402 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.831539236991131 [294] [581,379,1140,442] 8 hSpCas9 negative selection 6928046
28825665 28825688 16 - 27260156 G402 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.3461159804059725 [482] [1267,646,489,661] 4 hSpCas9 negative selection 6928047
28825391 28825414 16 - 27260156 G402 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.8495988266662724 [208] [209,183,86,98] -7 hSpCas9 negative selection 6928048
28826293 28826316 16 + 27260156 L33 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.10833981068654008 [467] [443,204,204,464] -2 hSpCas9 negative selection 6985013
28825804 28825827 16 - 27260156 L33 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.18688412495379125 [453] [464,209,386,475] 4 hSpCas9 negative selection 6985014
28826294 28826317 16 - 27260156 L33 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.002180608498575709 [323] [301,160,158,349] 0 hSpCas9 negative selection 6985015
28825820 28825843 16 + 27260156 L33 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.26457304512406943 [294] [357,167,224,291] 5 hSpCas9 negative selection 7049297
28825665 28825688 16 - 27260156 L33 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.02170972485480518 [482] [390,179,342,528] 0 hSpCas9 negative selection 7049298
28825391 28825414 16 - 27260156 L33 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.2906131454995813 [208] [573,55,91,157] 6 hSpCas9 negative selection 7049299
28826293 28826316 16 + 27260156 K562 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.34990931528745745 [467] [383,242,476,211] -4 hSpCas9 negative selection 7106264
28825804 28825827 16 - 27260156 K562 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.5096077909633648 [453] [165,449,268,248] -6 hSpCas9 negative selection 7106265
28826294 28826317 16 - 27260156 K562 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.1914303698439519 [323] [130,126,133,560] -2 hSpCas9 negative selection 7106266
28825820 28825843 16 + 27260156 K562 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.2865533363990571 [294] [338,307,452,191] 3 hSpCas9 negative selection 7170548
28825665 28825688 16 - 27260156 K562 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.2691843897284749 [482] [462,344,361,841] 3 hSpCas9 negative selection 7170549
28825391 28825414 16 - 27260156 K562 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.1493626470678111 [208] [190,115,169,187] -2 hSpCas9 negative selection 7170550
28826293 28826316 16 + 27260156 HT29 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.1530333827796031 [467] [694,826,516,521] 3 hSpCas9 negative selection 7227515
28825804 28825827 16 - 27260156 HT29 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.323391709819245 [453] [393,558,296,508] -6 hSpCas9 negative selection 7227516
28826294 28826317 16 - 27260156 HT29 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.23452807100463235 [323] [278,316,338,388] -5 hSpCas9 negative selection 7227517
28825820 28825843 16 + 27260156 HT29 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.3199107975482516 [294] [472,368,416,514] 6 hSpCas9 negative selection 7291799
28825665 28825688 16 - 27260156 HT29 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.017848050442800467 [482] [554,656,508,596] 0 hSpCas9 negative selection 7291800
28825391 28825414 16 - 27260156 HT29 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.013229679267979577 [208] [276,310,346,112] 0 hSpCas9 negative selection 7291801
28826293 28826316 16 + 27260156 MHHES1 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.28941633118826365 [467] [894,517,574,600] 5 hSpCas9 negative selection 7348766
28825804 28825827 16 - 27260156 MHHES1 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.3304172227386724 [453] [638,742,587,604] 6 hSpCas9 negative selection 7348767
28826294 28826317 16 - 27260156 MHHES1 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.007675691608028168 [323] [359,457,290,346] 0 hSpCas9 negative selection 7348768
28825820 28825843 16 + 27260156 MHHES1 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.1668692646681036 [294] [424,390,428,270] 3 hSpCas9 negative selection 7413050
28825665 28825688 16 - 27260156 MHHES1 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.015373579998328325 [482] [794,461,369,535] 0 hSpCas9 negative selection 7413051
28825391 28825414 16 - 27260156 MHHES1 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.3540070832523763 [208] [182,236,146,172] -6 hSpCas9 negative selection 7413052
28826293 28826316 16 + 27260156 MEWO viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.24800744112378822 [467] [492,382,253] -5 hSpCas9 negative selection 7470017
28825804 28825827 16 - 27260156 MEWO viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.15298487928093615 [453] [550,457,422] 3 hSpCas9 negative selection 7470018
28826294 28826317 16 - 27260156 MEWO viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.17715210006465754 [323] [447,238,361] 4 hSpCas9 negative selection 7470019
28825820 28825843 16 + 27260156 MEWO viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.1593354556640214 [294] [413,324,205] 3 hSpCas9 negative selection 7534301
28825665 28825688 16 - 27260156 MEWO viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.028865101759989194 [482] [469,426,436] 0 hSpCas9 negative selection 7534302
28825391 28825414 16 - 27260156 MEWO viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.18682978682875717 [208] [148,149,211] -4 hSpCas9 negative selection 7534303
28826293 28826316 16 + 27260156 LNCAPCLONEFGC viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.4506507007740337 [467] [312,311,367,255] -6 hSpCas9 negative selection 7591268
28825804 28825827 16 - 27260156 LNCAPCLONEFGC viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.5429163040192992 [453] [154,325,325,327] -7 hSpCas9 negative selection 7591269
28826294 28826317 16 - 27260156 LNCAPCLONEFGC viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.7315080154394713 [323] [153,143,199,214] -8 hSpCas9 negative selection 7591270
28825820 28825843 16 + 27260156 LNCAPCLONEFGC viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.4182068658058518 [294] [330,299,340,457] 6 hSpCas9 negative selection 7655552
28825665 28825688 16 - 27260156 LNCAPCLONEFGC viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.04101200620268951 [482] [389,321,416,675] 0 hSpCas9 negative selection 7655553
28825391 28825414 16 - 27260156 LNCAPCLONEFGC viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.12048755609114181 [208] [203,287,200,123] 1 hSpCas9 negative selection 7655554
28826293 28826316 16 + 27260156 PANC0327 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.22447571617309423 [467] [402,401,640,500] 3 hSpCas9 negative selection 7712519
28825804 28825827 16 - 27260156 PANC0327 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.8708146030859669 [453] [187,237,158,291] -8 hSpCas9 negative selection 7712520
28826294 28826317 16 - 27260156 PANC0327 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.07930464156136063 [323] [302,157,356,288] -1 hSpCas9 negative selection 7712521
28825820 28825843 16 + 27260156 PANC0327 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.17127211028513178 [294] [321,97,396,390] 2 hSpCas9 negative selection 7776803
28825665 28825688 16 - 27260156 PANC0327 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.5858264225279146 [482] [386,268,332,164] -7 hSpCas9 negative selection 7776804
28825391 28825414 16 - 27260156 PANC0327 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.5963348788823605 [208] [305,387,285,130] 8 hSpCas9 negative selection 7776805
28826293 28826316 16 + 27260156 NCIH2009 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.3670331710513464 [467] [1010,710,841] 5 hSpCas9 negative selection 7833770
28825804 28825827 16 - 27260156 NCIH2009 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.20633735175031997 [453] [655,581,943] 3 hSpCas9 negative selection 7833771
28826294 28826317 16 - 27260156 NCIH2009 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.02105164246518465 [323] [650,464,298] 0 hSpCas9 negative selection 7833772
28825820 28825843 16 + 27260156 NCIH2009 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.4814514923859292 [294] [814,392,567] 6 hSpCas9 negative selection 7898054
28825665 28825688 16 - 27260156 NCIH2009 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.011704149908949801 [482] [785,663,610] 0 hSpCas9 negative selection 7898055
28825391 28825414 16 - 27260156 NCIH2009 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.14759149552021755 [208] [200,263,312] -2 hSpCas9 negative selection 7898056
28826293 28826316 16 + 27260156 NCIH1373 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.24956802899596356 [467] [616,373,556,260] 2 hSpCas9 negative selection 7955021
28825804 28825827 16 - 27260156 NCIH1373 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.3640999377219387 [453] [432,263,395,134] -4 hSpCas9 negative selection 7955022
28826294 28826317 16 - 27260156 NCIH1373 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -1.088166518829391 [323] [144,131,183,58] -8 hSpCas9 negative selection 7955023
28825820 28825843 16 + 27260156 NCIH1373 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.6473362683322526 [294] [757,331,336,187] 6 hSpCas9 negative selection 8019305
28825665 28825688 16 - 27260156 NCIH1373 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.0906477577103285 [482] [413,562,480,145] -1 hSpCas9 negative selection 8019306
28825391 28825414 16 - 27260156 NCIH1373 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -1.0504932516284053 [208] [194,71,105,24] -8 hSpCas9 negative selection 8019307
28826293 28826316 16 + 27260156 PATU8902 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.3984648096591954 [467] [1129,752,730,842] 4 hSpCas9 negative selection 8076272
28825804 28825827 16 - 27260156 PATU8902 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.5667902255608521 [453] [860,1775,576,578] 6 hSpCas9 negative selection 8076273
28826294 28826317 16 - 27260156 PATU8902 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.3371169270070685 [323] [547,791,485,458] 3 hSpCas9 negative selection 8076274
28825820 28825843 16 + 27260156 PATU8902 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 1.0753722180177236 [294] [804,1117,468,1209] 9 hSpCas9 negative selection 8140556
28825665 28825688 16 - 27260156 PATU8902 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.9385114310633627 [482] [827,1429,1228,1734] 8 hSpCas9 negative selection 8140557
28825391 28825414 16 - 27260156 PATU8902 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.060831944098272306 [208] [208,434,232,361] 0 hSpCas9 negative selection 8140558
28826293 28826316 16 + 27260156 PANC1 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.21235066528103047 [467] [198,409,396,385] -3 hSpCas9 negative selection 8197523
28825804 28825827 16 - 27260156 PANC1 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.3959213952606614 [453] [370,311,292,218] -6 hSpCas9 negative selection 8197524
28826294 28826317 16 - 27260156 PANC1 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.06185512656040648 [323] [294,304,210,258] -1 hSpCas9 negative selection 8197525
28825820 28825843 16 + 27260156 PANC1 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.3135076855391669 [294] [217,462,352,261] 5 hSpCas9 negative selection 8261807
28825665 28825688 16 - 27260156 PANC1 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.007853886149646598 [482] [425,519,446,307] 0 hSpCas9 negative selection 8261808
28825391 28825414 16 - 27260156 PANC1 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.06333254041622238 [208] [145,215,160,170] -1 hSpCas9 negative selection 8261809
28826293 28826316 16 + 27260156 PANC0813 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.21998100587040564 [467] [659,665,566,666] 3 hSpCas9 negative selection 8318774
28825804 28825827 16 - 27260156 PANC0813 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.04364277723859082 [453] [530,619,722,334] 0 hSpCas9 negative selection 8318775
28826294 28826317 16 - 27260156 PANC0813 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.2600387747530294 [323] [416,535,419,445] 4 hSpCas9 negative selection 8318776
28825820 28825843 16 + 27260156 PANC0813 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.5975331027019708 [294] [543,756,324,473] 8 hSpCas9 negative selection 8383058
28825665 28825688 16 - 27260156 PANC0813 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.25717411124914724 [482] [496,349,497,550] -4 hSpCas9 negative selection 8383059
28825391 28825414 16 - 27260156 PANC0813 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.24665213875083736 [208] [257,75,367,134] -4 hSpCas9 negative selection 8383060
28826293 28826316 16 + 27260156 RDES viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.4358516996877486 [467] [584,511,1004,873] 7 hSpCas9 negative selection 8440025
28825804 28825827 16 - 27260156 RDES viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.4522367761730822 [453] [652,551,731,965] 7 hSpCas9 negative selection 8440026
28826294 28826317 16 - 27260156 RDES viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.13024674027130578 [323] [262,282,310,547] -2 hSpCas9 negative selection 8440027
28825820 28825843 16 + 27260156 RDES viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.6355843577075676 [294] [353,465,578,778] 8 hSpCas9 negative selection 8504309
28825665 28825688 16 - 27260156 RDES viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.3216508477870231 [482] [510,740,720,841] 5 hSpCas9 negative selection 8504310
28825391 28825414 16 - 27260156 RDES viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.3825994179008536 [208] [233,436,295,274] 6 hSpCas9 negative selection 8504311
28826293 28826316 16 + 27260156 PC3 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.26256465103780763 [467] [192,353,505,614] -5 hSpCas9 negative selection 8561276
28825804 28825827 16 - 27260156 PC3 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.3876591848416239 [453] [367,590,964,631] 7 hSpCas9 negative selection 8561277
28826294 28826317 16 - 27260156 PC3 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.04238798527583154 [323] [250,238,516,320] -1 hSpCas9 negative selection 8561278
28825820 28825843 16 + 27260156 PC3 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.09131975820229665 [294] [68,454,493,393] 2 hSpCas9 negative selection 8625560
28825665 28825688 16 - 27260156 PC3 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.1815141558786908 [482] [325,452,962,660] 4 hSpCas9 negative selection 8625561
28825391 28825414 16 - 27260156 PC3 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.016858458481922467 [208] [69,243,309,288] 0 hSpCas9 negative selection 8625562
28826293 28826316 16 + 27260156 PATU8988T viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.31677655212904127 [467] [522,351,295,273] -5 hSpCas9 negative selection 8682527
28825804 28825827 16 - 27260156 PATU8988T viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.822979576297978 [453] [350,244,148,247] -8 hSpCas9 negative selection 8682528
28826294 28826317 16 - 27260156 PATU8988T viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.2976050655223873 [323] [268,257,133,368] -5 hSpCas9 negative selection 8682529
28825820 28825843 16 + 27260156 PATU8988T viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.04995638563348215 [294] [296,281,382,208] 0 hSpCas9 negative selection 8746811
28825665 28825688 16 - 27260156 PATU8988T viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.20925781661147913 [482] [455,330,404,416] -4 hSpCas9 negative selection 8746812
28825391 28825414 16 - 27260156 PATU8988T viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.540304534027019 [208] [351,264,344,201] 8 hSpCas9 negative selection 8746813
28826293 28826316 16 + 27260156 T47D viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 -0.07933402243652876 [467] [522,513,536,488] -2 hSpCas9 negative selection 8803778
28825804 28825827 16 - 27260156 T47D viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.22046355037205276 [453] [448,429,407,533] -5 hSpCas9 negative selection 8803779
28826294 28826317 16 - 27260156 T47D viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.13554735983994404 [323] [354,352,339,324] -3 hSpCas9 negative selection 8803780
28825820 28825843 16 + 27260156 T47D viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.5064011205890139 [294] [583,458,455,455] 9 hSpCas9 negative selection 8868062
28825665 28825688 16 - 27260156 T47D viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.11352896182552472 [482] [593,525,677,643] 2 hSpCas9 negative selection 8868063
28825391 28825414 16 - 27260156 T47D viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.10014715046848965 [208] [198,224,279,202] -2 hSpCas9 negative selection 8868064
28826293 28826316 16 + 27260156 SU8686 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.5044556128065487 [467] [660,530,704,765] 8 hSpCas9 negative selection 8925029
28825804 28825827 16 - 27260156 SU8686 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.5070496700303974 [453] [593,594,705,677] 8 hSpCas9 negative selection 8925030
28826294 28826317 16 - 27260156 SU8686 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.19693924390394207 [323] [353,329,346,459] 3 hSpCas9 negative selection 8925031
28825820 28825843 16 + 27260156 SU8686 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.44401007677009635 [294] [286,473,409,424] 7 hSpCas9 negative selection 8989313
28825665 28825688 16 - 27260156 SU8686 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.018519758758578468 [482] [364,432,464,733] 0 hSpCas9 negative selection 8989314
28825391 28825414 16 - 27260156 SU8686 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.009352599984061793 [208] [83,149,376,242] 0 hSpCas9 negative selection 8989315
28826293 28826316 16 + 27260156 SKES1 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.13082049202718357 [467] [699,537,517,333] 3 hSpCas9 negative selection 9046280
28825804 28825827 16 - 27260156 SKES1 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.1451980984135569 [453] [607,466,457,478] 3 hSpCas9 negative selection 9046281
28826294 28826317 16 - 27260156 SKES1 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.026659911301313843 [323] [315,400,264,337] 0 hSpCas9 negative selection 9046282
28825820 28825843 16 + 27260156 SKES1 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.22249909965460463 [294] [384,415,234,348] 5 hSpCas9 negative selection 9110564
28825665 28825688 16 - 27260156 SKES1 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.17714447437987052 [482] [401,828,492,472] 4 hSpCas9 negative selection 9110565
28825391 28825414 16 - 27260156 SKES1 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.004597567567348193 [208] [162,253,275,146] 0 hSpCas9 negative selection 9110566
28826293 28826316 16 + 27260156 TOV112D viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.08890828052370993 [467] [411,885,417,368] 1 hSpCas9 negative selection 9167531
28825804 28825827 16 - 27260156 TOV112D viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.0015503720649403113 [453] [457,528,435,412] 0 hSpCas9 negative selection 9167532
28826294 28826317 16 - 27260156 TOV112D viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.29575822845899324 [323] [260,263,353,179] -5 hSpCas9 negative selection 9167533
28825820 28825843 16 + 27260156 TOV112D viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.31988708079295886 [294] [388,350,438,294] 6 hSpCas9 negative selection 9231815
28825665 28825688 16 - 27260156 TOV112D viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 -0.029715360759442862 [482] [293,519,531,542] 0 hSpCas9 negative selection 9231816
28825391 28825414 16 - 27260156 TOV112D viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 0.08998840714642542 [208] [324,158,186,212] 1 hSpCas9 negative selection 9231817
28826293 28826316 16 + 27260156 TC71 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.14613660307971116 [467] [443,541,637,598] 3 hSpCas9 negative selection 9288782
28825804 28825827 16 - 27260156 TC71 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 0.29145672094383324 [453] [489,576,625,696] 7 hSpCas9 negative selection 9288783
28826294 28826317 16 - 27260156 TC71 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 -0.008774548019368944 [323] [405,282,249,449] 0 hSpCas9 negative selection 9288784
28825820 28825843 16 + 27260156 TC71 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.4006851590268385 [294] [361,375,431,505] 8 hSpCas9 negative selection 9353066
28825665 28825688 16 - 27260156 TC71 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.03172890446779865 [482] [412,589,572,542] 0 hSpCas9 negative selection 9353067
28825391 28825414 16 - 27260156 TC71 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.16372600342450405 [208] [210,161,184,244] -4 hSpCas9 negative selection 9353068
28826293 28826316 16 + 27260156 TC32 viability CCCTCGTCGGGAGGACATTGTGG ATXN2L ENSG00000168488 0.09797609968081837 [467] [539,289,534,565] 1 hSpCas9 negative selection 9410033
28825804 28825827 16 - 27260156 TC32 viability CTTGAAGATACCCTCATAAGTGG ATXN2L ENSG00000168488 -0.2402943395648879 [453] [334,158,519,528] -4 hSpCas9 negative selection 9410034
28826294 28826317 16 - 27260156 TC32 viability TCCACAATGTCCTCCCGACGAGG ATXN2L ENSG00000168488 0.02774337984706665 [323] [208,410,289,278] 0 hSpCas9 negative selection 9410035
28825820 28825843 16 + 27260156 TC32 viability CTTCAAGACGCTAAGCTCAAAGG ATXN2L ENSG00000168488 0.2565829215778955 [294] [339,300,322,348] 4 hSpCas9 negative selection 9474317
28825665 28825688 16 - 27260156 TC32 viability AACTTACCACAACAGCTGTAAGG ATXN2L ENSG00000168488 0.15085606599492107 [482] [359,387,683,656] 2 hSpCas9 negative selection 9474318
28825391 28825414 16 - 27260156 TC32 viability AAGACACTCACAGGTGACTGTGG ATXN2L ENSG00000168488 -0.057539678968767216 [208] [217,158,221,154] -1 hSpCas9 negative selection 9474319
28826247 28826270 16 + 27869803 HPAFII viability after 27 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 0.5936242626112922 [270] [232,199,NaN] 5 hSpCas9 negative selection 9556479
28826880 28826903 16 - 27869803 HPAFII viability after 27 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 1.0144078071290783 [254] [338,213,NaN] 8 hSpCas9 negative selection 9556480
28830043 28830066 16 - 27869803 HPAFII viability after 27 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 1.0991887526958766 [397] [438,455,NaN] 8 hSpCas9 negative selection 9556481
28826247 28826270 16 + 27869803 HPAFII viability after 15 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -0.11788626250538776 [270] [260,272,NaN] -1 hSpCas9 negative selection 9638928
28826880 28826903 16 - 27869803 HPAFII viability after 15 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.9895052304427004 [254] [783,394,NaN] 9 hSpCas9 negative selection 9638929
28830043 28830066 16 - 27869803 HPAFII viability after 15 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.6926178807645439 [397] [760,647,NaN] 7 hSpCas9 negative selection 9638930
28826247 28826270 16 + 27869803 ASPC1 viability after 36 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 0.12953422926869343 [699] [214,293,279] 1 hSpCas9 negative selection 9721377
28826880 28826903 16 - 27869803 ASPC1 viability after 36 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.034685379136897995 [656] [351,160,208] 0 hSpCas9 negative selection 9721378
28830043 28830066 16 - 27869803 ASPC1 viability after 36 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 0.5619900683158543 [820] [144,224,770] 5 hSpCas9 negative selection 9721379
28826247 28826270 16 + 27869803 PATU8988S viability after 35 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -1.585467551433016 [494] [35,96,NaN] -8 hSpCas9 negative selection 9803826
28826880 28826903 16 - 27869803 PATU8988S viability after 35 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 -0.3863603310125824 [619] [207,173,NaN] -4 hSpCas9 negative selection 9803827
28830043 28830066 16 - 27869803 PATU8988S viability after 35 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.829121641618211 [930] [234,186,NaN] -7 hSpCas9 negative selection 9803828
28826247 28826270 16 + 27869803 PATU8988S viability after 31 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 -2.1382082132089 [494] [28,64,NaN] -9 hSpCas9 negative selection 9886275
28826880 28826903 16 - 27869803 PATU8988S viability after 31 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 0.02593408590149801 [619] [179,342,NaN] 0 hSpCas9 negative selection 9886276
28830043 28830066 16 - 27869803 PATU8988S viability after 31 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 -0.7767612666433241 [930] [206,228,NaN] -7 hSpCas9 negative selection 9886277
28826247 28826270 16 + 27869803 HPAFII viability after 35 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 1.161161094267987 [270] [168,461,NaN] 7 hSpCas9 negative selection 9968724
28826880 28826903 16 - 27869803 HPAFII viability after 35 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 1.2022270251345961 [254] [368,215,NaN] 7 hSpCas9 negative selection 9968725
28830043 28830066 16 - 27869803 HPAFII viability after 35 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 1.21095882163333 [397] [369,574,NaN] 7 hSpCas9 negative selection 9968726
28826247 28826270 16 + 27869803 HPAFII viability after 31 days TAGCCGTGGATGCTGTGCACCGG ATXN2L ENSG00000168488 1.2080752328569069 [270] [247,463,NaN] 8 hSpCas9 negative selection 10051173
28826880 28826903 16 - 27869803 HPAFII viability after 31 days CACTTTCGAGTTCATGGCAATGG ATXN2L ENSG00000168488 1.3888849231188827 [254] [458,282,NaN] 8 hSpCas9 negative selection 10051174
28830043 28830066 16 - 27869803 HPAFII viability after 31 days CAGTCACCTGGATGCCAAGCTGG ATXN2L ENSG00000168488 1.1471150063314264 [397] [509,477,NaN] 8 hSpCas9 negative selection 10051175
28826270 28826293 16 + 28162770 P31FUJ viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 0.3150982020852327 [183] [268] 3 hSpCas9 negative selection 10116342
28826921 28826944 16 + 28162770 P31FUJ viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 0.230169771928167 [258] [356] 2 hSpCas9 negative selection 10116343
28829948 28829971 16 + 28162770 P31FUJ viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.170586807968681 [589] [307] -7 hSpCas9 negative selection 10116344
28826270 28826293 16 + 28162770 TF1 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 NaN [NaN] [126] 1 hSpCas9 negative selection 10285708
28826921 28826944 16 + 28162770 TF1 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 NaN [NaN] [384] 1 hSpCas9 negative selection 10285709
28829948 28829971 16 + 28162770 TF1 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 NaN [NaN] [261] 1 hSpCas9 negative selection 10285710
28826270 28826293 16 + 28162770 SKM1 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.24521312874654966 [58] [87] -2 hSpCas9 negative selection 10455074
28826921 28826944 16 + 28162770 SKM1 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.7857815101092522 [117] [120] -5 hSpCas9 negative selection 10455075
28829948 28829971 16 + 28162770 SKM1 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.640761383351859 [126] [71] -8 hSpCas9 negative selection 10455076
28826270 28826293 16 + 28162770 SKM1 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.24521312874654966 [58] [87] -2 hSpCas9 negative selection 10624440
28826921 28826944 16 + 28162770 SKM1 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.7857815101092522 [117] [120] -5 hSpCas9 negative selection 10624441
28829948 28829971 16 + 28162770 SKM1 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.640761383351859 [126] [71] -8 hSpCas9 negative selection 10624442
28826270 28826293 16 + 28162770 PL21 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.6393957133174337 [203] [56] -4 hSpCas9 negative selection 10793806
28826921 28826944 16 + 28162770 PL21 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 0.1352398396962251 [340] [162] 1 hSpCas9 negative selection 10793807
28829948 28829971 16 + 28162770 PL21 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.3431751888733447 [477] [81] -7 hSpCas9 negative selection 10793808
28826270 28826293 16 + 28162770 P31FUJ viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 0.3150982020852327 [183] [268] 3 hSpCas9 negative selection 10963172
28826921 28826944 16 + 28162770 P31FUJ viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 0.230169771928167 [258] [356] 2 hSpCas9 negative selection 10963173
28829948 28829971 16 + 28162770 P31FUJ viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.170586807968681 [589] [307] -7 hSpCas9 negative selection 10963174
28826270 28826293 16 + 28162770 OCIAML5 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 0.025250909361174467 [91] [168] 0 hSpCas9 negative selection 11132538
28826921 28826944 16 + 28162770 OCIAML5 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -1.2671040701428407 [155] [116] -6 hSpCas9 negative selection 11132539
28829948 28829971 16 + 28162770 OCIAML5 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.542489579093173 [304] [188] -7 hSpCas9 negative selection 11132540
28826270 28826293 16 + 28162770 EOL1 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -2.4144538366757695 [424] [41] -8 hSpCas9 negative selection 11301904
28826921 28826944 16 + 28162770 EOL1 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.6947348023344979 [552] [179] -5 hSpCas9 negative selection 11301905
28829948 28829971 16 + 28162770 EOL1 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.0326673619326692 [597] [153] -6 hSpCas9 negative selection 11301906
28826270 28826293 16 + 28162770 MOLM13 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 0.42566114615528144 [311] [302] 3 hSpCas9 negative selection 11471270
28826921 28826944 16 + 28162770 MOLM13 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.7385614959228476 [389] [168] -4 hSpCas9 negative selection 11471271
28829948 28829971 16 + 28162770 MOLM13 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.8275665019815925 [647] [131] -7 hSpCas9 negative selection 11471272
28826270 28826293 16 + 28162770 HEL viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.028424703770102883 [249] [156] 0 hSpCas9 negative selection 11640636
28826921 28826944 16 + 28162770 HEL viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 0.003394760857629686 [418] [268] 0 hSpCas9 negative selection 11640637
28829948 28829971 16 + 28162770 HEL viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.0097146949434714 [546] [173] -6 hSpCas9 negative selection 11640638
28826270 28826293 16 + 28162770 MV411 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.6524954941133023 [180] [96] -4 hSpCas9 negative selection 11810002
28826921 28826944 16 + 28162770 MV411 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 0.2937312030567102 [275] [284] 2 hSpCas9 negative selection 11810003
28829948 28829971 16 + 28162770 MV411 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.145347141648941 [385] [146] -6 hSpCas9 negative selection 11810004
28826270 28826293 16 + 28162770 MONOMAC1 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.1536442515461729 [130] [134] -1 hSpCas9 negative selection 11979368
28826921 28826944 16 + 28162770 MONOMAC1 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.12405740170244817 [211] [222] -1 hSpCas9 negative selection 11979369
28829948 28829971 16 + 28162770 MONOMAC1 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.0498108938763757 [241] [133] -7 hSpCas9 negative selection 11979370
28826270 28826293 16 + 28162770 OCIAML2 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 -0.3288558641139978 [45] [202] -3 hSpCas9 negative selection 12148734
28826921 28826944 16 + 28162770 OCIAML2 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.5221601258822433 [56] [219] -4 hSpCas9 negative selection 12148735
28829948 28829971 16 + 28162770 OCIAML2 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -0.8789099583456961 [70] [213] -6 hSpCas9 negative selection 12148736
28826270 28826293 16 + 28162770 OCIAML3 viability AAAGCATCTGAGCCAGCAGGTGG ATXN2L ENSG00000168488 0.16498426017204204 [51] [175] 1 hSpCas9 negative selection 12318100
28826921 28826944 16 + 28162770 OCIAML3 viability AAGGTGCTTCAGCGCTGGGAGGG ATXN2L ENSG00000168488 -0.0534392589614604 [76] [223] 0 hSpCas9 negative selection 12318101
28829948 28829971 16 + 28162770 OCIAML3 viability GTACCGCCTACGGATCGCCATGG ATXN2L ENSG00000168488 -1.7087192992008557 [156] [144] -8 hSpCas9 negative selection 12318102