Crispr

Gene Info

• Species: Human (Homo sapiens)
• GeneID: 2592
• Symbol: GALT
• Description: galactose-1-phosphate uridylyltransferase

DataSource: http://genomecrispr.dkfz.de/#!/results/GALT

Export (tab separated) Export to Excel

Start	The end	chr	strand	pubmed	cellline	condition	sequence	symbol	ensg	log2fc	rc_initial	rc_final	effect	cas	screentype	index
34646411	34646434	9	+	25494202	A375	resistance to PLX-4720 (puromycin)	AGCAAGTCCTGTAGGCATCCTGG	GALT	ENSG00000213930	1.1632580279140534	[223,117]	[125,37]	4	dCas9-VP64	positive selection	2383303
34646465	34646488	9	+	25494202	A375	resistance to PLX-4720 (puromycin)	CAGAGGTTCTTCCAGTGTAGTGG	GALT	ENSG00000213930	0.6963730080767159	[133,33]	[46,9]	3	dCas9-VP64	positive selection	2383304
34646487	34646510	9	+	25494202	A375	resistance to PLX-4720 (puromycin)	GCTCTAGCTCTGGGTGAAGTAGG	GALT	ENSG00000213930	0.1466570940455767	[6,32]	[2,5]	0	dCas9-VP64	positive selection	2383305
34646411	34646434	9	+	25494202	A375	resistance to PLX-4720 (zeocin)	AGCAAGTCCTGTAGGCATCCTGG	GALT	ENSG00000213930	-0.07433016191107789	[369,278]	[75,123]	0	dCas9-VP64	positive selection	2478558
34646465	34646488	9	+	25494202	A375	resistance to PLX-4720 (zeocin)	CAGAGGTTCTTCCAGTGTAGTGG	GALT	ENSG00000213930	0.34387400830868103	[180,55]	[82,17]	2	dCas9-VP64	positive selection	2478559
34646487	34646510	9	+	25494202	A375	resistance to PLX-4720 (zeocin)	GCTCTAGCTCTGGGTGAAGTAGG	GALT	ENSG00000213930	1.5680456293506342	[42,37]	[16,59]	8	dCas9-VP64	positive selection	2478560