Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 64225
  • Symbol: ATL2
  • Description: atlastin GTPase 2
DataSource: http://genomecrispr.dkfz.de/#!/results/ATL2

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
38377251 38377274 2 - 26472758 Jiyoye viability AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 0.2759308482276207 [114] [104] 2 hSpCas9 negative selection 11915
38318611 38318634 2 - 26472758 Jiyoye viability GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -3.2468287636449342 [213] [16] -9 hSpCas9 negative selection 11916
38377213 38377236 2 - 26472758 Jiyoye viability GAGGGCAGCAACCGCACCAGGGG ATL2 ENSG00000119787 -1.030229930801425 [64] [23] -6 hSpCas9 negative selection 11917
38377156 38377179 2 + 26472758 Jiyoye viability GGACGAGACGTGGTTAACCGCGG ATL2 ENSG00000119787 -1.4622405086839825 [189] [51] -7 hSpCas9 negative selection 11918
38314634 38314657 2 - 26472758 Jiyoye viability AGAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 2.7291034763932354 [0] [4] 9 hSpCas9 negative selection 11919
38298431 38298454 2 + 26472758 Jiyoye viability CAAGCTGGTCCTGATAACGACGG ATL2 ENSG00000119787 -1.2789659535826503 [250] [77] -7 hSpCas9 negative selection 11920
38377173 38377196 2 - 26472758 Jiyoye viability GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -1.708301835914063 [12] [2] -8 hSpCas9 negative selection 11921
38377146 38377169 2 + 26472758 Jiyoye viability GGGAGGTCGTGGACGAGACGTGG ATL2 ENSG00000119787 -2.499715214102645 [14] [1] -9 hSpCas9 negative selection 11922
38377129 38377152 2 + 26472758 Jiyoye viability TCGCTGGCCCGTACCTAGGGAGG ATL2 ENSG00000119787 -4.480349889235714 [147] [4] -9 hSpCas9 negative selection 11923
38318958 38318981 2 - 26472758 Jiyoye viability ACAGGCTTTACATGGCGAGGTGG ATL2 ENSG00000119787 -4.976528910968179 [166] [3] -9 hSpCas9 negative selection 11924
38377251 38377274 2 - 26472758 KBM7 viability AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 0.0606530823313986 [532,472] [267,226] 0 hSpCas9 negative selection 203033
38318611 38318634 2 - 26472758 KBM7 viability GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -3.2315995061404754 [262,388] [21,11] -9 hSpCas9 negative selection 203034
38377213 38377236 2 - 26472758 KBM7 viability GAGGGCAGCAACCGCACCAGGGG ATL2 ENSG00000119787 -1.4431391100248476 [499,269] [57,70] -7 hSpCas9 negative selection 203035
38377156 38377179 2 + 26472758 KBM7 viability GGACGAGACGTGGTTAACCGCGG ATL2 ENSG00000119787 -1.2443466996411154 [500,520] [99,103] -7 hSpCas9 negative selection 203036
38314634 38314657 2 - 26472758 KBM7 viability AGAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -3.7571383220546153 [64,47] [2,0] -9 hSpCas9 negative selection 203037
38298431 38298454 2 + 26472758 KBM7 viability CAAGCTGGTCCTGATAACGACGG ATL2 ENSG00000119787 -2.6754632339840576 [1521,1187] [146,55] -9 hSpCas9 negative selection 203038
38377173 38377196 2 - 26472758 KBM7 viability GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -1.0124372538092685 [53,54] [16,8] -7 hSpCas9 negative selection 203039
38377146 38377169 2 + 26472758 KBM7 viability GGGAGGTCGTGGACGAGACGTGG ATL2 ENSG00000119787 -4.341148773978715 [43,41] [0,0] -9 hSpCas9 negative selection 203040
38377129 38377152 2 + 26472758 KBM7 viability TCGCTGGCCCGTACCTAGGGAGG ATL2 ENSG00000119787 -1.7882024386145992 [446,561] [44,91] -8 hSpCas9 negative selection 203041
38318958 38318981 2 - 26472758 KBM7 viability ACAGGCTTTACATGGCGAGGTGG ATL2 ENSG00000119787 -1.9179316738909955 [620,375] [83,39] -8 hSpCas9 negative selection 203042
38377251 38377274 2 - 26472758 Raji viability AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -1.3520480832636976 [263] [23] -7 hSpCas9 negative selection 394151
38318611 38318634 2 - 26472758 Raji viability GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -1.1821230818213855 [175] [17] -7 hSpCas9 negative selection 394152
38377213 38377236 2 - 26472758 Raji viability GAGGGCAGCAACCGCACCAGGGG ATL2 ENSG00000119787 -0.03945785295567161 [154] [34] 0 hSpCas9 negative selection 394153
38377156 38377179 2 + 26472758 Raji viability GGACGAGACGTGGTTAACCGCGG ATL2 ENSG00000119787 -0.17949761241456225 [243] [49] -1 hSpCas9 negative selection 394154
38314634 38314657 2 - 26472758 Raji viability AGAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 3.1073835353735992 [0] [1] 9 hSpCas9 negative selection 394155
38298431 38298454 2 + 26472758 Raji viability CAAGCTGGTCCTGATAACGACGG ATL2 ENSG00000119787 0.11046951524734228 [466] [116] 1 hSpCas9 negative selection 394156
38377173 38377196 2 - 26472758 Raji viability GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 0.20049293976508098 [44] [11] 2 hSpCas9 negative selection 394157
38377146 38377169 2 + 26472758 Raji viability GGGAGGTCGTGGACGAGACGTGG ATL2 ENSG00000119787 -1.352048083263698 [10] [0] -7 hSpCas9 negative selection 394158
38377129 38377152 2 + 26472758 Raji viability TCGCTGGCCCGTACCTAGGGAGG ATL2 ENSG00000119787 -0.06626455211143017 [193] [42] 0 hSpCas9 negative selection 394159
38318958 38318981 2 - 26472758 Raji viability ACAGGCTTTACATGGCGAGGTGG ATL2 ENSG00000119787 -0.28995196217178526 [215] [40] -2 hSpCas9 negative selection 394160
38377251 38377274 2 - 26472758 K562 viability AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.45754041667184625 [474] [291] -3 hSpCas9 negative selection 585269
38318611 38318634 2 - 26472758 K562 viability GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -3.728814362770768 [266] [16] -9 hSpCas9 negative selection 585270
38377213 38377236 2 - 26472758 K562 viability GAGGGCAGCAACCGCACCAGGGG ATL2 ENSG00000119787 -0.918811621201857 [214] [95] -5 hSpCas9 negative selection 585271
38377156 38377179 2 + 26472758 K562 viability GGACGAGACGTGGTTAACCGCGG ATL2 ENSG00000119787 -0.5923911049199687 [333] [186] -4 hSpCas9 negative selection 585272
38314634 38314657 2 - 26472758 K562 viability AGAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -2.478047296804644 [32] [4] -8 hSpCas9 negative selection 585273
38298431 38298454 2 + 26472758 K562 viability CAAGCTGGTCCTGATAACGACGG ATL2 ENSG00000119787 -1.2849149042010066 [1220] [422] -6 hSpCas9 negative selection 585274
38377173 38377196 2 - 26472758 K562 viability GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -1.2048886736971434 [70] [25] -6 hSpCas9 negative selection 585275
38377146 38377169 2 + 26472758 K562 viability GGGAGGTCGTGGACGAGACGTGG ATL2 ENSG00000119787 -4.2791432283905655 [22] [0] -9 hSpCas9 negative selection 585276
38377129 38377152 2 + 26472758 K562 viability TCGCTGGCCCGTACCTAGGGAGG ATL2 ENSG00000119787 -4.519867472499271 [461] [16] -9 hSpCas9 negative selection 585277
38318958 38318981 2 - 26472758 K562 viability ACAGGCTTTACATGGCGAGGTGG ATL2 ENSG00000119787 -5.029842933590601 [386] [9] -9 hSpCas9 negative selection 585278
38296008 38296031 2 + 26627737 DLD1 viability ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.8830133148984558 [346] [41,45,83] -7 hSpCas9 negative selection 811882
38298143 38298166 2 - 26627737 DLD1 viability TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 0.48022390136449866 [1062] [484,524,393] 5 hSpCas9 negative selection 811883
38310348 38310371 2 + 26627737 DLD1 viability TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -4.2488714861904775 [709] [23,1,8] -9 hSpCas9 negative selection 811884
38318612 38318635 2 - 26627737 DLD1 viability TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -4.171434043804527 [677] [30,0,3] -9 hSpCas9 negative selection 811885
38318961 38318984 2 - 26627737 DLD1 viability TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -3.7232789496738032 [1316] [16,44,31] -9 hSpCas9 negative selection 811886
38377251 38377274 2 - 26627737 DLD1 viability AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.7861191159451084 [396] [12,158,50] -6 hSpCas9 negative selection 811887
38296008 38296031 2 + 26627737 GBM cells viability after 5 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.62542226688397 [232] [40,120] -7 hSpCas9 negative selection 894197
38298143 38298166 2 - 26627737 GBM cells viability after 5 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 0.4571924274618566 [672] [503,486] 7 hSpCas9 negative selection 894198
38310348 38310371 2 + 26627737 GBM cells viability after 5 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.18812639462966974 [445] [254,289] 3 hSpCas9 negative selection 894199
38318612 38318635 2 - 26627737 GBM cells viability after 5 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -0.926755944552001 [217] [62,59] -8 hSpCas9 negative selection 894200
38318961 38318984 2 - 26627737 GBM cells viability after 5 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.414662139567896 [731] [276,311] -6 hSpCas9 negative selection 894201
38377251 38377274 2 - 26627737 GBM cells viability after 5 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.3755252942203575 [126] [48,55] -5 hSpCas9 negative selection 894202
38296008 38296031 2 + 26627737 GBM cells viability after 13 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.38457813718229544 [232] [119,77] -4 hSpCas9 negative selection 976512
38298143 38298166 2 - 26627737 GBM cells viability after 13 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 0.5157293113899284 [672] [590,465] 6 hSpCas9 negative selection 976513
38310348 38310371 2 + 26627737 GBM cells viability after 13 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.21706337194409653 [445] [288,274] 2 hSpCas9 negative selection 976514
38318612 38318635 2 - 26627737 GBM cells viability after 13 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.2074292848620956 [217] [80,26] -8 hSpCas9 negative selection 976515
38318961 38318984 2 - 26627737 GBM cells viability after 13 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.33583750680845004 [731] [376,263] -4 hSpCas9 negative selection 976516
38377251 38377274 2 - 26627737 GBM cells viability after 13 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.03843556090195355 [126] [49,80] 0 hSpCas9 negative selection 976517
38296008 38296031 2 + 26627737 GBM cells viability after 21 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -2.337534141196076 [232] [23,25] -9 hSpCas9 negative selection 1058827
38298143 38298166 2 - 26627737 GBM cells viability after 21 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 0.45801649551707446 [672] [519,485] 5 hSpCas9 negative selection 1058828
38310348 38310371 2 + 26627737 GBM cells viability after 21 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.719176526963455 [445] [424,374] 7 hSpCas9 negative selection 1058829
38318612 38318635 2 - 26627737 GBM cells viability after 21 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -2.3699755041228343 [217] [24,20] -9 hSpCas9 negative selection 1058830
38318961 38318984 2 - 26627737 GBM cells viability after 21 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.4068615966047613 [731] [300,298] -4 hSpCas9 negative selection 1058831
38377251 38377274 2 - 26627737 GBM cells viability after 21 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.8006181221549318 [126] [36,41] -6 hSpCas9 negative selection 1058832
38296008 38296031 2 + 26627737 RPE1 viability after 9 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.09696097925340696 [520] [155,147] 0 hSpCas9 negative selection 1141142
38298143 38298166 2 - 26627737 RPE1 viability after 9 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.1875495410364807 [1532] [1000,1211] 7 hSpCas9 negative selection 1141143
38310348 38310371 2 + 26627737 RPE1 viability after 9 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.12712683470621478 [1059] [323,411] 0 hSpCas9 negative selection 1141144
38318612 38318635 2 - 26627737 RPE1 viability after 9 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.8063518912945287 [942] [100,62] -8 hSpCas9 negative selection 1141145
38318961 38318984 2 - 26627737 RPE1 viability after 9 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -1.5468411128233865 [2520] [301,228] -8 hSpCas9 negative selection 1141146
38377251 38377274 2 - 26627737 RPE1 viability after 9 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -1.3631296212692392 [812] [70,134] -7 hSpCas9 negative selection 1141147
38296008 38296031 2 + 26627737 RPE1 viability after 12 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.45943439941703734 [520] [94,108] -3 hSpCas9 negative selection 1223457
38298143 38298166 2 - 26627737 RPE1 viability after 12 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.3778652264182654 [1532] [1031,1110] 7 hSpCas9 negative selection 1223458
38310348 38310371 2 + 26627737 RPE1 viability after 12 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -0.5585063016024404 [1059] [205,179] -4 hSpCas9 negative selection 1223459
38318612 38318635 2 - 26627737 RPE1 viability after 12 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.5349696283669108 [942] [152,17] -8 hSpCas9 negative selection 1223460
38318961 38318984 2 - 26627737 RPE1 viability after 12 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -1.8803310734922045 [2520] [199,166] -8 hSpCas9 negative selection 1223461
38377251 38377274 2 - 26627737 RPE1 viability after 12 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -2.7632920352666273 [812] [20,43] -9 hSpCas9 negative selection 1223462
38296008 38296031 2 + 26627737 RPE1 viability after 15 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 0.3150355035219693 [520] [191,174] 2 hSpCas9 negative selection 1305772
38298143 38298166 2 - 26627737 RPE1 viability after 15 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.307682962386512 [1532] [1355,800] 7 hSpCas9 negative selection 1305773
38310348 38310371 2 + 26627737 RPE1 viability after 15 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -1.3705689598058393 [1059] [117,113] -7 hSpCas9 negative selection 1305774
38318612 38318635 2 - 26627737 RPE1 viability after 15 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.8904377684515898 [942] [130,14] -8 hSpCas9 negative selection 1305775
38318961 38318984 2 - 26627737 RPE1 viability after 15 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -1.718301472849016 [2520] [203,228] -8 hSpCas9 negative selection 1305776
38377251 38377274 2 - 26627737 RPE1 viability after 15 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -1.0542439882161452 [812] [124,96] -6 hSpCas9 negative selection 1305777
38296008 38296031 2 + 26627737 RPE1 viability after 18 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 0.07213292830840601 [520] [83,215] 0 hSpCas9 negative selection 1388087
38298143 38298166 2 - 26627737 RPE1 viability after 18 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.1517002696746683 [1532] [850,991] 6 hSpCas9 negative selection 1388088
38310348 38310371 2 + 26627737 RPE1 viability after 18 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -1.2153884432995135 [1059] [157,85] -6 hSpCas9 negative selection 1388089
38318612 38318635 2 - 26627737 RPE1 viability after 18 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.862358051635765 [942] [127,7] -8 hSpCas9 negative selection 1388090
38318961 38318984 2 - 26627737 RPE1 viability after 18 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -2.1870941113101012 [2520] [160,136] -8 hSpCas9 negative selection 1388091
38377251 38377274 2 - 26627737 RPE1 viability after 18 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -2.117675603224938 [812] [22,79] -8 hSpCas9 negative selection 1388092
38296008 38296031 2 + 26627737 HeLa viability after 8 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 1.274683846297028 [133] [211,28,193] 8 hSpCas9 negative selection 1470402
38298143 38298166 2 - 26627737 HeLa viability after 8 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.4731436389110582 [499] [308,683,743] 9 hSpCas9 negative selection 1470403
38310348 38310371 2 + 26627737 HeLa viability after 8 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.37515110543139474 [645] [504,304,317] 3 hSpCas9 negative selection 1470404
38318612 38318635 2 - 26627737 HeLa viability after 8 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -0.8588526062650517 [542] [125,60,197] -7 hSpCas9 negative selection 1470405
38318961 38318984 2 - 26627737 HeLa viability after 8 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.6580678692470485 [1532] [477,477,330] -6 hSpCas9 negative selection 1470406
38377251 38377274 2 - 26627737 HeLa viability after 8 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.5979005077274623 [198] [122,18,44] -5 hSpCas9 negative selection 1470407
38296008 38296031 2 + 26627737 HeLa viability after 12 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 1.6949013432156674 [133] [202,108,233] 9 hSpCas9 negative selection 1552717
38298143 38298166 2 - 26627737 HeLa viability after 12 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.6876802914338518 [499] [864,445,714] 9 hSpCas9 negative selection 1552718
38310348 38310371 2 + 26627737 HeLa viability after 12 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.1600201612455031 [645] [323,303,266] 1 hSpCas9 negative selection 1552719
38318612 38318635 2 - 26627737 HeLa viability after 12 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -0.9826649565396417 [542] [78,100,160] -7 hSpCas9 negative selection 1552720
38318961 38318984 2 - 26627737 HeLa viability after 12 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.33138993816380213 [1532] [708,347,475] -3 hSpCas9 negative selection 1552721
38377251 38377274 2 - 26627737 HeLa viability after 12 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.7654055906709439 [198] [37,27,80] -6 hSpCas9 negative selection 1552722
38296008 38296031 2 + 26627737 HeLa viability after 15 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 0.8009804206550978 [133] [158,33,90] 6 hSpCas9 negative selection 1635032
38298143 38298166 2 - 26627737 HeLa viability after 15 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.4631180329173568 [499] [614,420,653] 8 hSpCas9 negative selection 1635033
38310348 38310371 2 + 26627737 HeLa viability after 15 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.08408872423943214 [645] [250,302,282] 0 hSpCas9 negative selection 1635034
38318612 38318635 2 - 26627737 HeLa viability after 15 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -0.45606305938509195 [542] [130,104,254] -4 hSpCas9 negative selection 1635035
38318961 38318984 2 - 26627737 HeLa viability after 15 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -1.5110998161478117 [1532] [73,253,339] -8 hSpCas9 negative selection 1635036
38377251 38377274 2 - 26627737 HeLa viability after 15 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.6677520843306263 [198] [68,53,27] -5 hSpCas9 negative selection 1635037
38296008 38296031 2 + 26627737 HeLa viability after 18 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 0.7993707121117144 [133] [104,29,90] 6 hSpCas9 negative selection 1717347
38298143 38298166 2 - 26627737 HeLa viability after 18 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 1.4742765582114283 [499] [415,354,653] 8 hSpCas9 negative selection 1717348
38310348 38310371 2 + 26627737 HeLa viability after 18 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.0943582908289331 [645] [172,249,282] 0 hSpCas9 negative selection 1717349
38318612 38318635 2 - 26627737 HeLa viability after 18 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -0.44164134196041493 [542] [90,86,254] -4 hSpCas9 negative selection 1717350
38318961 38318984 2 - 26627737 HeLa viability after 18 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -1.4766464213112613 [1532] [48,223,339] -8 hSpCas9 negative selection 1717351
38377251 38377274 2 - 26627737 HeLa viability after 18 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.6774924809673634 [198] [46,42,27] -5 hSpCas9 negative selection 1717352
38296008 38296031 2 + 26627737 HCT116 viability after 6 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.05592641537421861 [485] [19,102] 0 hSpCas9 negative selection 1799662
38298143 38298166 2 - 26627737 HCT116 viability after 6 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 0.2628380529697627 [1854] [307,372] 1 hSpCas9 negative selection 1799663
38310348 38310371 2 + 26627737 HCT116 viability after 6 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -1.1135430203951886 [929] [122,36] -6 hSpCas9 negative selection 1799664
38318612 38318635 2 - 26627737 HCT116 viability after 6 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.7612468346812533 [618] [58,11] -7 hSpCas9 negative selection 1799665
38318961 38318984 2 - 26627737 HCT116 viability after 6 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 1.0773731616959685 [1452] [1074,154] 6 hSpCas9 negative selection 1799666
38377251 38377274 2 - 26627737 HCT116 viability after 6 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 1.5704957354258302 [232] [296,4] 7 hSpCas9 negative selection 1799667
38296008 38296031 2 + 26627737 HCT116 viability after 8 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.4995477104590139 [300] [89,105,154] -5 hSpCas9 negative selection 1881977
38298143 38298166 2 - 26627737 HCT116 viability after 8 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 0.18351179057557232 [868] [527,550,551] 2 hSpCas9 negative selection 1881978
38310348 38310371 2 + 26627737 HCT116 viability after 8 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -0.5270597460227688 [738] [300,338,208] -6 hSpCas9 negative selection 1881979
38318612 38318635 2 - 26627737 HCT116 viability after 8 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.448208314441334 [448] [79,115,75] -9 hSpCas9 negative selection 1881980
38318961 38318984 2 - 26627737 HCT116 viability after 8 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.6828907855677113 [794] [334,232,251] -7 hSpCas9 negative selection 1881981
38377251 38377274 2 - 26627737 HCT116 viability after 8 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.9621536138076812 [297] [119,90,42] -8 hSpCas9 negative selection 1881982
38296008 38296031 2 + 26627737 HCT116 viability after 9 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -1.8553234025110688 [485] [60,15] -8 hSpCas9 negative selection 1964292
38298143 38298166 2 - 26627737 HCT116 viability after 9 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 -0.7204519296155771 [1854] [351,259] -5 hSpCas9 negative selection 1964293
38310348 38310371 2 + 26627737 HCT116 viability after 9 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 0.6819636930293536 [929] [551,276] 5 hSpCas9 negative selection 1964294
38318612 38318635 2 - 26627737 HCT116 viability after 9 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 0.01590991218462586 [618] [289,69] 0 hSpCas9 negative selection 1964295
38318961 38318984 2 - 26627737 HCT116 viability after 9 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -1.324459647646177 [1452] [293,44] -7 hSpCas9 negative selection 1964296
38377251 38377274 2 - 26627737 HCT116 viability after 9 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 0.4928315174663681 [232] [67,102] 3 hSpCas9 negative selection 1964297
38296008 38296031 2 + 26627737 HCT116 viability after 12 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.9644568029637788 [300] [67,66,108] -8 hSpCas9 negative selection 2046607
38298143 38298166 2 - 26627737 HCT116 viability after 12 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 -0.052400967520085384 [868] [448,422,447] 0 hSpCas9 negative selection 2046608
38310348 38310371 2 + 26627737 HCT116 viability after 12 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -0.3537448065528471 [738] [426,347,126] -4 hSpCas9 negative selection 2046609
38318612 38318635 2 - 26627737 HCT116 viability after 12 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -1.609558535647636 [448] [94,59,74] -9 hSpCas9 negative selection 2046610
38318961 38318984 2 - 26627737 HCT116 viability after 12 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.8657137882980156 [794] [189,217,282] -7 hSpCas9 negative selection 2046611
38377251 38377274 2 - 26627737 HCT116 viability after 12 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.9044862947348827 [297] [64,98,88] -7 hSpCas9 negative selection 2046612
38296008 38296031 2 + 26627737 HCT116 viability after 15 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -1.030909727875102 [300] [132,67,58] -8 hSpCas9 negative selection 2128922
38298143 38298166 2 - 26627737 HCT116 viability after 15 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 -0.02749109230777691 [868] [594,417,468] 0 hSpCas9 negative selection 2128923
38310348 38310371 2 + 26627737 HCT116 viability after 15 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -0.7963468784974537 [738] [226,258,244] -7 hSpCas9 negative selection 2128924
38318612 38318635 2 - 26627737 HCT116 viability after 15 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -2.332757593615507 [448] [54,45,52] -9 hSpCas9 negative selection 2128925
38318961 38318984 2 - 26627737 HCT116 viability after 15 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.9514348169640623 [794] [241,229,236] -7 hSpCas9 negative selection 2128926
38377251 38377274 2 - 26627737 HCT116 viability after 15 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.5807762281839051 [297] [145,76,123] -6 hSpCas9 negative selection 2128927
38296008 38296031 2 + 26627737 HCT116 viability after 18 days ATCTGGCATGATGAGACACCTGG ATL2 ENSG00000119787 -0.15603939176098558 [300] [148,69,178] -1 hSpCas9 negative selection 2211237
38298143 38298166 2 - 26627737 HCT116 viability after 18 days TGCTGAAACACTATGGGAACAGG ATL2 ENSG00000119787 0.08385417939514705 [868] [569,220,564] 0 hSpCas9 negative selection 2211238
38310348 38310371 2 + 26627737 HCT116 viability after 18 days TAAGACCAGGATGTGGCAAAAGG ATL2 ENSG00000119787 -0.5081483443747019 [738] [316,160,282] -5 hSpCas9 negative selection 2211239
38318612 38318635 2 - 26627737 HCT116 viability after 18 days TGTGCTGCTTATGGATACCCAGG ATL2 ENSG00000119787 -2.5808075818674143 [448] [29,28,50] -9 hSpCas9 negative selection 2211240
38318961 38318984 2 - 26627737 HCT116 viability after 18 days TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.7992529785524795 [794] [212,211,238] -6 hSpCas9 negative selection 2211241
38377251 38377274 2 - 26627737 HCT116 viability after 18 days AAATCGGTACAAGATGGCGGAGG ATL2 ENSG00000119787 -0.7803326266174107 [297] [42,148,53] -6 hSpCas9 negative selection 2211242
38371228 38371251 2 - 25494202 A375 resistance to PLX-4720 (puromycin) CAGGCATCAGCCACCACACCCAG ATL2 ENSG00000119787 3.13947332771205 [140,99] [396,56] 8 dCas9-VP64 positive selection 2409147
38327883 38327906 2 - 25494202 A375 resistance to PLX-4720 (puromycin) GGAGTGCGGTGGCACAATCTCGG ATL2 ENSG00000119787 0.34388664028494687 [9,101] [1,29] 1 dCas9-VP64 positive selection 2425851
38365599 38365622 2 - 25494202 A375 resistance to PLX-4720 (puromycin) AGATGGGGTTTCACTATGTTGGG ATL2 ENSG00000119787 -1.0998643350942743 [293,186] [24,23] -6 dCas9-VP64 positive selection 2468201
38364868 38364891 2 - 25494202 A375 resistance to PLX-4720 (puromycin) TTGTATTTTTAGTAGAGACGGAG ATL2 ENSG00000119787 4.010018042841921 [201,101] [623,445] 9 dCas9-VP64 positive selection 2473527
38371228 38371251 2 - 25494202 A375 resistance to PLX-4720 (zeocin) CAGGCATCAGCCACCACACCCAG ATL2 ENSG00000119787 2.698989317197104 [135,124] [110,433] 9 dCas9-VP64 positive selection 2504402
38327883 38327906 2 - 25494202 A375 resistance to PLX-4720 (zeocin) GGAGTGCGGTGGCACAATCTCGG ATL2 ENSG00000119787 -0.06548600402502203 [51,72] [16,20] 0 dCas9-VP64 positive selection 2521106
38365599 38365622 2 - 25494202 A375 resistance to PLX-4720 (zeocin) AGATGGGGTTTCACTATGTTGGG ATL2 ENSG00000119787 -0.2266176027776325 [165,194] [50,48] -2 dCas9-VP64 positive selection 2563456
38364868 38364891 2 - 25494202 A375 resistance to PLX-4720 (zeocin) TTGTATTTTTAGTAGAGACGGAG ATL2 ENSG00000119787 1.087060795387326 [282,711] [216,460] 7 dCas9-VP64 positive selection 2568782
38377231 38377254 2 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity AGGGGGACGAGGCAGCGCGAGGG ATL2 ENSG00000119787 -1.0509500981488735 [3,3] [1,0] -9 hSpCas9 positive selection 2972237
38377173 38377196 2 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -1.1691071537276798 [2,3] [1,0] -9 hSpCas9 positive selection 2972238
38318611 38318634 2 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 0.0063286542825624625 [4,5] [4,4] 0 hSpCas9 positive selection 2972239
38318961 38318984 2 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.13343069380898454 [3,3] [3,1] -2 hSpCas9 positive selection 2972240
38377231 38377254 2 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity AGGGGGACGAGGCAGCGCGAGGG ATL2 ENSG00000119787 -0.28875846663430765 [3,3] [1,1] -4 hSpCas9 positive selection 3040095
38377173 38377196 2 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -0.3262094507153284 [2,2] [2,0] -5 hSpCas9 positive selection 3040096
38318611 38318634 2 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -0.1854686061935739 [4,4] [4,1] -3 hSpCas9 positive selection 3040097
38318961 38318984 2 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.4467382144846347 [3,3] [2,0] -6 hSpCas9 positive selection 3040098
38299290 38299313 - 24336571 A375 resistance to PLX after 7 days AATAATCTTGCTGCAGTAGCAGG ATL2 ENSG00000119787 -0.2023937780169286 [21,19] [16,18] -6 hSpCas9 positive selection 3135754
38343342 38343365 - 24336571 A375 resistance to PLX after 7 days ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 0.5784877473033233 [5,8] [11,9] 9 hSpCas9 positive selection 3135765
38299256 38299279 + 24336571 A375 resistance to PLX after 7 days CTGTTCCATACTTTTACAATAGG ATL2 ENSG00000119787 0.2887878711265677 [5,9] [10,8] 7 hSpCas9 positive selection 3135776
38343314 38343337 - 24336571 A375 resistance to PLX after 7 days GTGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.4134715757281078 [16,11] [17,20] 9 hSpCas9 positive selection 3135783
38343431 38343454 + 24336571 A375 resistance to PLX after 7 days TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 0.5559730794079601 [7,11] [12,15] 9 hSpCas9 positive selection 3135794
38299290 38299313 - 24336571 A375 resistance to PLX after 14 days AATAATCTTGCTGCAGTAGCAGG ATL2 ENSG00000119787 -0.3603018924346151 [25,18] [7,7] -4 hSpCas9 positive selection 3193547
38343342 38343365 - 24336571 A375 resistance to PLX after 14 days ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 1.1082012176609009 [4,4] [3,4] 8 hSpCas9 positive selection 3193558
38299256 38299279 + 24336571 A375 resistance to PLX after 14 days CTGTTCCATACTTTTACAATAGG ATL2 ENSG00000119787 0.5581466242351478 [6,5] [2,4] 5 hSpCas9 positive selection 3193569
38343314 38343337 - 24336571 A375 resistance to PLX after 14 days GTGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 2.1080600949737223 [14,9] [24,26] 9 hSpCas9 positive selection 3193576
38343431 38343454 + 24336571 A375 resistance to PLX after 14 days TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.18353399992246433 [10,7] [4,1] -2 hSpCas9 positive selection 3193587
38299290 38299313 - 24336571 A375 viability after 7 days AATAATCTTGCTGCAGTAGCAGG ATL2 ENSG00000119787 0.16767997050906502 [19] [21,19] 2 hSpCas9 negative selection 3251340
38343342 38343365 - 24336571 A375 viability after 7 days ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.673549323758274 [24] [5,8] -9 hSpCas9 negative selection 3251351
38299256 38299279 + 24336571 A375 viability after 7 days CTGTTCCATACTTTTACAATAGG ATL2 ENSG00000119787 -0.708536649164388 [13] [5,9] -7 hSpCas9 negative selection 3251362
38343314 38343337 - 24336571 A375 viability after 7 days GTGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.26545417514626457 [12] [16,11] 4 hSpCas9 negative selection 3251369
38343431 38343454 + 24336571 A375 viability after 7 days TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -1.3674987441898903 [26] [7,11] -9 hSpCas9 negative selection 3251380
38299290 38299313 - 24336571 A375 viability after 14 days AATAATCTTGCTGCAGTAGCAGG ATL2 ENSG00000119787 0.30068286191186067 [19] [25,18] 4 hSpCas9 negative selection 3309133
38343342 38343365 - 24336571 A375 viability after 14 days ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -2.174236124727921 [24] [4,4] -9 hSpCas9 negative selection 3309144
38299256 38299279 + 24336571 A375 viability after 14 days CTGTTCCATACTTTTACAATAGG ATL2 ENSG00000119787 -0.9709953330038018 [13] [6,5] -8 hSpCas9 negative selection 3309155
38343314 38343337 - 24336571 A375 viability after 14 days GTGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.0757884593127336 [12] [14,9] 1 hSpCas9 negative selection 3309162
38343431 38343454 + 24336571 A375 viability after 14 days TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -1.3286926030673913 [26] [10,7] -9 hSpCas9 negative selection 3309173
38343342 38343365 2 - 27383988 293T resistance to West Nile virus (flavivirus) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 0.3562621496000984 [121,116] [0,0] 1 hSpCas9 positive selection 3337975
38318964 38318987 2 + 27383988 293T resistance to West Nile virus (flavivirus) CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 0.6506246599815698 [90,103] [0,0] 3 hSpCas9 positive selection 3337976
38343431 38343454 2 + 27383988 293T resistance to West Nile virus (flavivirus) TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 0.14402664733126902 [131,144] [0,0] 0 hSpCas9 positive selection 3337977
38318576 38318599 2 + 27383988 293T resistance to West Nile virus (flavivirus) CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.6068599332084452 [232,232] [0,0] -4 hSpCas9 positive selection 3357228
38318621 38318644 2 - 27383988 293T resistance to West Nile virus (flavivirus) CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 -0.5174608481553384 [218,218] [0,0] -3 hSpCas9 positive selection 3357229
38318976 38318999 2 - 27383988 293T resistance to West Nile virus (flavivirus) GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 0.6723637107246789 [95,95] [0,0] 3 hSpCas9 positive selection 3357230
38377231 38377254 2 - 26780180 HT29 viability (Avana library 4 designs) AGGGGGACGAGGCAGCGCGAGGG ATL2 ENSG00000119787 2.58665401169291 [] [] 8 hSpCas9 negative selection 3408376
38377173 38377196 2 - 26780180 HT29 viability (Avana library 4 designs) GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 2.78728570708131 [] [] 8 hSpCas9 negative selection 3408377
38318611 38318634 2 - 26780180 HT29 viability (Avana library 4 designs) GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 1.89603084850123 [] [] 7 hSpCas9 negative selection 3408378
38318961 38318984 2 - 26780180 HT29 viability (Avana library 4 designs) TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 2.31201108072844 [] [] 8 hSpCas9 negative selection 3408379
38377173 38377196 2 - 26780180 A375 viability (Avana lentiCRISPRv2) GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -6.35767070290598 [] [] -6 hSpCas9 negative selection 3481885
38318611 38318634 2 - 26780180 A375 viability (Avana lentiCRISPRv2) GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -12.4204850179465 [] [] -8 hSpCas9 negative selection 3481886
38377231 38377254 2 - 26780180 A375 viability (Avana lentiCRISPRv2) AGGGGGACGAGGCAGCGCGAGGG ATL2 ENSG00000119787 -8.40277832900707 [] [] -7 hSpCas9 negative selection 3481887
38318961 38318984 2 - 26780180 A375 viability (Avana lentiCRISPRv2) TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -7.75247324239129 [] [] -7 hSpCas9 negative selection 3481888
38343267 38343290 2 - 26780180 A375 viability (Avana lentiCRISPRv2) GCTTAGATACATGTATAACAAGG ATL2 ENSG00000119787 -13.5214209788534 [] [] -8 hSpCas9 negative selection 3481889
38343342 38343365 2 - 26780180 A375 viability (Avana lentiCRISPRv2) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -21.2945181639053 [] [] -9 hSpCas9 negative selection 3481890
38377173 38377196 2 - 26780180 A375 viability (Avana lentiGuide) GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 6.59028816645252 [] [] 5 hSpCas9 negative selection 3590544
38318611 38318634 2 - 26780180 A375 viability (Avana lentiGuide) GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 31.0635333605832 [] [] 9 hSpCas9 negative selection 3590545
38377231 38377254 2 - 26780180 A375 viability (Avana lentiGuide) AGGGGGACGAGGCAGCGCGAGGG ATL2 ENSG00000119787 22.3469006213407 [] [] 9 hSpCas9 negative selection 3590546
38318961 38318984 2 - 26780180 A375 viability (Avana lentiGuide) TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 27.5756051048185 [] [] 9 hSpCas9 negative selection 3590547
38343267 38343290 2 - 26780180 A375 viability (Avana lentiGuide) GCTTAGATACATGTATAACAAGG ATL2 ENSG00000119787 18.2521519322226 [] [] 8 hSpCas9 negative selection 3590548
38343342 38343365 2 - 26780180 A375 viability (Avana lentiGuide) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 20.0420690168141 [] [] 8 hSpCas9 negative selection 3590549
38377173 38377196 2 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -0.32814248017756203 [4] [4,2] -5 hSpCas9 positive selection 3699203
38318611 38318634 2 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -0.656464665599226 [6] [6,0] -7 hSpCas9 positive selection 3699204
38377231 38377254 2 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AGGGGGACGAGGCAGCGCGAGGG ATL2 ENSG00000119787 -0.5501941109331931 [4] [3,1] -7 hSpCas9 positive selection 3699205
38318961 38318984 2 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.04968891155726973 [4] [4,4] -1 hSpCas9 positive selection 3699206
38343267 38343290 2 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCTTAGATACATGTATAACAAGG ATL2 ENSG00000119787 -1.521970201564013 [8] [2,1] -9 hSpCas9 positive selection 3699207
38343342 38343365 2 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.6788237354063784 [9] [4,5] -7 hSpCas9 positive selection 3699208
38377173 38377196 2 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GACCAGCGACCCAAGCGCCGCGG ATL2 ENSG00000119787 -0.314103356978767 [5] [3,3] -4 hSpCas9 positive selection 3807810
38318611 38318634 2 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GTGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -0.7332754602727272 [6] [4,2] -7 hSpCas9 positive selection 3807811
38377231 38377254 2 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AGGGGGACGAGGCAGCGCGAGGG ATL2 ENSG00000119787 -1.050201843961727 [5] [0,2] -8 hSpCas9 positive selection 3807812
38318961 38318984 2 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) TTGACAGGCTTTACATGGCGAGG ATL2 ENSG00000119787 -0.452554751393879 [5] [4,1] -5 hSpCas9 positive selection 3807813
38343267 38343290 2 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCTTAGATACATGTATAACAAGG ATL2 ENSG00000119787 -0.4558247137416034 [5] [2,3] -5 hSpCas9 positive selection 3807814
38343342 38343365 2 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.9284890092943812 [6] [3,1] -8 hSpCas9 positive selection 3807815
38343342 38343365 2 - 26780180 A375 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 2.16741979753112 [] [] 9 hSpCas9 negative selection 3916059
38318576 38318599 2 + 26780180 A375 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 1.23957409416245 [] [] 6 hSpCas9 negative selection 3916060
38318964 38318987 2 + 26780180 A375 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 1.91568750837267 [] [] 9 hSpCas9 negative selection 3916061
38318621 38318644 2 - 26780180 A375 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.954746301214107 [] [] 4 hSpCas9 negative selection 3916062
38318976 38318999 2 - 26780180 A375 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 1.62938604270983 [] [] 8 hSpCas9 negative selection 3916063
38343431 38343454 2 + 26780180 A375 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 2.1663141265577 [] [] 9 hSpCas9 negative selection 3916064
38343342 38343365 2 - 26780180 HT29 viability (GeCKOv2 library) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 1.92552191190824 [] [] 9 hSpCas9 negative selection 4024025
38318576 38318599 2 + 26780180 HT29 viability (GeCKOv2 library) CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 1.34438153859668 [] [] 6 hSpCas9 negative selection 4024026
38318964 38318987 2 + 26780180 HT29 viability (GeCKOv2 library) CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 1.8161006723662 [] [] 8 hSpCas9 negative selection 4024027
38318621 38318644 2 - 26780180 HT29 viability (GeCKOv2 library) CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.656787399699932 [] [] 2 hSpCas9 negative selection 4024028
38318976 38318999 2 - 26780180 HT29 viability (GeCKOv2 library) GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 1.86271784153041 [] [] 8 hSpCas9 negative selection 4024029
38343431 38343454 2 + 26780180 HT29 viability (GeCKOv2 library) TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 1.85785004066203 [] [] 8 hSpCas9 negative selection 4024030
38299290 38299313 2 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) AATAATCTTGCTGCAGTAGCAGG ATL2 ENSG00000119787 0.018436867651684202 [4] [2,2] 0 hSpCas9 positive selection 4160718
38343342 38343365 2 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.2757056973284561 [3] [1,2] -6 hSpCas9 positive selection 4160729
38299256 38299279 2 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CTGTTCCATACTTTTACAATAGG ATL2 ENSG00000119787 -0.16656391862530479 [2] [1,1] -4 hSpCas9 positive selection 4160740
38343314 38343337 2 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) GTGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.3056870775877479 [3] [2,4] 7 hSpCas9 positive selection 4160752
38343431 38343454 2 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.3719656573242234 [3] [1,1] -7 hSpCas9 positive selection 4160763
38299290 38299313 2 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) AATAATCTTGCTGCAGTAGCAGG ATL2 ENSG00000119787 0.8826450850126346 [4] [3,4,2,3] 6 hSpCas9 positive selection 4224740
38343342 38343365 2 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.795475086782003 [4] [1,0,0,0] -9 hSpCas9 positive selection 4224751
38299256 38299279 2 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CTGTTCCATACTTTTACAATAGG ATL2 ENSG00000119787 0.9349537486336528 [5] [5,5,2,3] 6 hSpCas9 positive selection 4224762
38343314 38343337 2 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) GTGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.48102732020130123 [1] [1,0,0,0] 3 hSpCas9 positive selection 4224774
38343431 38343454 2 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.5356297656792806 [4] [1,0,1,0] -7 hSpCas9 positive selection 4224785
38343342 38343365 2 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.43477432507719094 [3] [2,1] -7 hSpCas9 positive selection 4257219
38318964 38318987 2 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 0.016307690339141173 [2] [2,1] 0 hSpCas9 positive selection 4257220
38343431 38343454 2 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.3106655826722531 [3] [2,1] -6 hSpCas9 positive selection 4257221
38318576 38318599 2 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 0.01993525045154515 [3] [3,2] 0 hSpCas9 positive selection 4321503
38318621 38318644 2 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.14037676561026674 [3] [3,1] 3 hSpCas9 positive selection 4321504
38318976 38318999 2 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.6346616507103697 [2] [1,0] -9 hSpCas9 positive selection 4321505
38343314 38343336 2 - 27760321 OCIAML3 viability TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.520381796235311 [279,221] [192,392] 6 hSpCas9 negative selection 4380335
38343342 38343364 2 - 27760321 OCIAML3 viability CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 1.3193442996247113 [43,33] [75,74] 9 hSpCas9 negative selection 4380336
38343438 38343460 2 + 27760321 OCIAML3 viability GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -0.20515078796759134 [281,221] [158,183] -2 hSpCas9 negative selection 4380337
38314634 38314656 2 - 27760321 OCIAML3 viability GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -0.650130067792686 [1,1] [0,0] -6 hSpCas9 negative selection 4380338
38318611 38318633 2 - 27760321 OCIAML3 viability TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -0.07722536725913112 [502,449] [245,491] -1 hSpCas9 negative selection 4380339
38343314 38343336 2 - 27760321 OCIAML2 viability TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -0.5974783223044146 [279,221] [100,175] -6 hSpCas9 negative selection 4463798
38343342 38343364 2 - 27760321 OCIAML2 viability CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -2.244423342678128 [43,33] [0,13] -9 hSpCas9 negative selection 4463799
38343438 38343460 2 + 27760321 OCIAML2 viability GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -0.0582078613499456 [281,221] [200,185] -1 hSpCas9 negative selection 4463800
38314634 38314656 2 - 27760321 OCIAML2 viability GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -0.6988754330577347 [1,1] [0,0] -6 hSpCas9 negative selection 4463801
38318611 38318633 2 - 27760321 OCIAML2 viability TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -1.050564142006731 [502,449] [143,240] -7 hSpCas9 negative selection 4463802
38343314 38343336 2 - 27760321 MV411 viability TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -0.42133117858007807 [279,221] [24,269] -3 hSpCas9 negative selection 4547261
38343342 38343364 2 - 27760321 MV411 viability CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 1.7551633829865785 [43,33] [142,0] 9 hSpCas9 negative selection 4547262
38343438 38343460 2 + 27760321 MV411 viability GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -0.08693958436938343 [281,221] [99,238] 0 hSpCas9 negative selection 4547263
38314634 38314656 2 - 27760321 MV411 viability GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -0.40505149887800407 [1,1] [0,0] -3 hSpCas9 negative selection 4547264
38318611 38318633 2 - 27760321 MV411 viability TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -1.329517783547776 [502,449] [72,202] -7 hSpCas9 negative selection 4547265
38343314 38343336 2 - 27760321 HL60 viability TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -1.0781489976702399 [279,221] [129,60] -8 hSpCas9 negative selection 4630724
38343342 38343364 2 - 27760321 HL60 viability CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.697863354026988 [43,33] [17,0] -9 hSpCas9 negative selection 4630725
38343438 38343460 2 + 27760321 HL60 viability GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 0.35286590075599394 [281,221] [283,236] 4 hSpCas9 negative selection 4630726
38314634 38314656 2 - 27760321 HL60 viability GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -0.7129216606721407 [1,1] [0,0] -6 hSpCas9 negative selection 4630727
38318611 38318633 2 - 27760321 HL60 viability TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -1.8257666176063911 [502,449] [114,103] -9 hSpCas9 negative selection 4630728
38343314 38343336 2 - 27760321 HT1080 viability TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -1.9955670892541115 [221,172] [13,25] -6 hSpCas9 negative selection 4714187
38343342 38343364 2 - 27760321 HT1080 viability CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -3.604469782789593 [33,26] [0,0] -7 hSpCas9 negative selection 4714188
38343438 38343460 2 + 27760321 HT1080 viability GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -1.9643125152302594 [221,172] [12,27] -6 hSpCas9 negative selection 4714189
38314634 38314656 2 - 27760321 HT1080 viability GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 5.46180328525341 [1,1] [38,31] 9 hSpCas9 negative selection 4714190
38318611 38318633 2 - 27760321 HT1080 viability TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -7.3177883281333544 [449,350] [0,0] -9 hSpCas9 negative selection 4714191
38343314 38343336 2 - 27760321 HT29 viability after 7 days TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.715431694191367 [221,172] [356,544,341] 9 hSpCas9 negative selection 4797650
38343342 38343364 2 - 27760321 HT29 viability after 7 days CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.09733787682354711 [33,26] [64,41,7] -1 hSpCas9 negative selection 4797651
38343438 38343460 2 + 27760321 HT29 viability after 7 days GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 0.022831432197929935 [221,172] [266,383,127] 0 hSpCas9 negative selection 4797652
38314634 38314656 2 - 27760321 HT29 viability after 7 days GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -1.3840325596302083 [1,1] [0,0,0] -9 hSpCas9 negative selection 4797653
38318611 38318633 2 - 27760321 HT29 viability after 7 days TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -0.1244838499510171 [449,350] [632,325,479] -2 hSpCas9 negative selection 4797654
38343314 38343336 2 - 27760321 HT29 viability after 25 days TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -0.9092896798913345 [221,172] [136,155,59] -6 hSpCas9 negative selection 4881113
38343342 38343364 2 - 27760321 HT29 viability after 25 days CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.618884237690267 [33,26] [8,19,41] -5 hSpCas9 negative selection 4881114
38343438 38343460 2 + 27760321 HT29 viability after 25 days GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -0.16216960668825264 [221,172] [219,169,214] -2 hSpCas9 negative selection 4881115
38314634 38314656 2 - 27760321 HT29 viability after 25 days GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -1.214054570927468 [1,1] [0,0,0] -7 hSpCas9 negative selection 4881116
38318611 38318633 2 - 27760321 HT29 viability after 25 days TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -2.531603354421218 [449,350] [99,82,49] -8 hSpCas9 negative selection 4881117
38343314 38343336 2 - 27760321 HT29 viability after 22 days TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -0.5041628078618253 [221,172] [301,128,46] -5 hSpCas9 negative selection 4964576
38343342 38343364 2 - 27760321 HT29 viability after 22 days CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.8655620136564552 [33,26] [12,2,12] -8 hSpCas9 negative selection 4964577
38343438 38343460 2 + 27760321 HT29 viability after 22 days GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -0.4247603671806609 [221,172] [154,145,209] -4 hSpCas9 negative selection 4964578
38314634 38314656 2 - 27760321 HT29 viability after 22 days GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -1.2313732027867275 [1,1] [0,0,0] -7 hSpCas9 negative selection 4964579
38318611 38318633 2 - 27760321 HT29 viability after 22 days TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -1.84904505980064 [449,350] [140,135,107] -8 hSpCas9 negative selection 4964580
38343314 38343336 2 - 27760321 HT29 viability after 19 days TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 0.06838529986968267 [221,172] [400,317,16] 0 hSpCas9 negative selection 5048039
38343342 38343364 2 - 27760321 HT29 viability after 19 days CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.1862299042199318 [33,26] [47,0,0] -7 hSpCas9 negative selection 5048040
38343438 38343460 2 + 27760321 HT29 viability after 19 days GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -0.08239538004413571 [221,172] [265,344,40] -1 hSpCas9 negative selection 5048041
38314634 38314656 2 - 27760321 HT29 viability after 19 days GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -1.2155331503635143 [1,1] [0,0,0] -7 hSpCas9 negative selection 5048042
38318611 38318633 2 - 27760321 HT29 viability after 19 days TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -1.7269033584656313 [449,350] [243,148,36] -7 hSpCas9 negative selection 5048043
38343314 38343336 2 - 27760321 HT29 viability after 16 days TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -0.1971698949411581 [221,172] [161,277,132] -2 hSpCas9 negative selection 5131502
38343342 38343364 2 - 27760321 HT29 viability after 16 days CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.9064797988105058 [33,26] [48,1,6] -6 hSpCas9 negative selection 5131503
38343438 38343460 2 + 27760321 HT29 viability after 16 days GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 -0.080939492622629 [221,172] [354,148,137] -1 hSpCas9 negative selection 5131504
38314634 38314656 2 - 27760321 HT29 viability after 16 days GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -1.1840686979425925 [1,1] [0,0,0] -7 hSpCas9 negative selection 5131505
38318611 38318633 2 - 27760321 HT29 viability after 16 days TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -1.2332426736681255 [449,350] [257,117,203] -7 hSpCas9 negative selection 5131506
38343314 38343336 2 - 27760321 HT29 viability after 13 days TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -0.11523941022515294 [221,172] [244,238,153] -1 hSpCas9 negative selection 5214965
38343342 38343364 2 - 27760321 HT29 viability after 13 days CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.0548273003531587 [33,26] [27,3,18] -7 hSpCas9 negative selection 5214966
38343438 38343460 2 + 27760321 HT29 viability after 13 days GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 0.6231322123826311 [221,172] [300,461,298] 7 hSpCas9 negative selection 5214967
38314634 38314656 2 - 27760321 HT29 viability after 13 days GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -1.2363560973867305 [1,1] [0,0,0] -8 hSpCas9 negative selection 5214968
38318611 38318633 2 - 27760321 HT29 viability after 13 days TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -0.912386862101666 [449,350] [291,228,220] -7 hSpCas9 negative selection 5214969
38343314 38343336 2 - 27760321 HT29 viability after 10 days TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -0.27737203876578465 [221,172] [262,150,194] -4 hSpCas9 negative selection 5298428
38343342 38343364 2 - 27760321 HT29 viability after 10 days CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -2.4404968354199053 [33,26] [12,2,4] -9 hSpCas9 negative selection 5298429
38343438 38343460 2 + 27760321 HT29 viability after 10 days GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 0.2080349569830121 [221,172] [322,299,232] 2 hSpCas9 negative selection 5298430
38314634 38314656 2 - 27760321 HT29 viability after 10 days GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -1.3423674045470744 [1,1] [0,0,0] -8 hSpCas9 negative selection 5298431
38318611 38318633 2 - 27760321 HT29 viability after 10 days TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -0.43251502118055263 [449,350] [491,286,330] -5 hSpCas9 negative selection 5298432
38343314 38343336 2 - 27760321 MOLM13 viability TGGCAGGAGCTTTTCGTAAAGG ATL2 ENSG00000119787 -1.1789525280045825 [279,221] [133,0] -6 hSpCas9 negative selection 5381891
38343342 38343364 2 - 27760321 MOLM13 viability CGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.4452059552188912 [43,33] [0,13] -7 hSpCas9 negative selection 5381892
38343438 38343460 2 + 27760321 MOLM13 viability GAACAATCTGTACTGGACATGG ATL2 ENSG00000119787 1.0403804587412036 [281,221] [195,370] 7 hSpCas9 negative selection 5381893
38314634 38314656 2 - 27760321 MOLM13 viability GAGTATGGAAGACTTGCGATGG ATL2 ENSG00000119787 -0.1789946860504088 [1,1] [0,0] -1 hSpCas9 negative selection 5381894
38318611 38318633 2 - 27760321 MOLM13 viability TGCTGCTTATGGATACCCAGGG ATL2 ENSG00000119787 -5.390313541560045 [502,449] [0,10] -9 hSpCas9 negative selection 5381895
38376819 38376842 2 + 27661255 K562 viability GCCGCCCCCTAAGGTCGGGGCGG ATL2 ENSG00000119787 -0.04839748143047973 [245,206] [161,186] -2 dCas9-KRAB negative selection 5464056
38376823 38376846 2 - 27661255 K562 viability GTGTCCGCCCCGACCTTAGGGGG ATL2 ENSG00000119787 -0.01752103529068494 [1549,1633] [1347,1175] 0 dCas9-KRAB negative selection 5464057
38376905 38376928 2 - 27661255 K562 viability GTAGCTGCTGGGAGAACCAGTGG ATL2 ENSG00000119787 -0.2736241078332303 [1139,1443] [861,839] -6 dCas9-KRAB negative selection 5464058
38377213 38377236 2 - 27661255 K562 viability GAGGGCAGCAACCGCACCAGGGG ATL2 ENSG00000119787 -0.5222620831785298 [1368,1593] [919,737] -7 dCas9-KRAB negative selection 5464059
38343342 38343365 2 - 27260156 BXPC3 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.8081119382163375 [674] [315,452,351,506] -9 hSpCas9 negative selection 5529679
38318964 38318987 2 + 27260156 BXPC3 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.3203585406200451 [368] [227,285,365,372] -6 hSpCas9 negative selection 5529680
38343431 38343454 2 + 27260156 BXPC3 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.6141968400803967 [628] [316,422,483,515] -8 hSpCas9 negative selection 5529681
38318576 38318599 2 + 27260156 BXPC3 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.5616846597618631 [849] [571,545,547,763] -8 hSpCas9 negative selection 5593963
38318621 38318644 2 - 27260156 BXPC3 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.2914690266696314 [531] [542,760,651,784] 6 hSpCas9 negative selection 5593964
38318976 38318999 2 - 27260156 BXPC3 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.139896407958989 [217] [100,90,79,146] -9 hSpCas9 negative selection 5593965
38343342 38343365 2 - 27260156 A673 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.1716640115543086 [674] [789,771,524,802] -4 hSpCas9 negative selection 5650930
38318964 38318987 2 + 27260156 A673 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.274853258584541 [368] [327,278,412,445] -6 hSpCas9 negative selection 5650931
38343431 38343454 2 + 27260156 A673 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.3209480103033613 [628] [494,553,715,641] -7 hSpCas9 negative selection 5650932
38318576 38318599 2 + 27260156 A673 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.41614383328441024 [849] [794,634,677,968] -7 hSpCas9 negative selection 5715214
38318621 38318644 2 - 27260156 A673 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.22045412332571818 [531] [726,831,681,729] 5 hSpCas9 negative selection 5715215
38318976 38318999 2 - 27260156 A673 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.2845176324872043 [217] [255,124,193,295] -6 hSpCas9 negative selection 5715216
38343342 38343365 2 - 27260156 A375 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.3253266469466385 [674] [305,313,293,339] -9 hSpCas9 negative selection 5772181
38318964 38318987 2 + 27260156 A375 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -1.4396008041091122 [368] [187,257,136,75] -9 hSpCas9 negative selection 5772182
38343431 38343454 2 + 27260156 A375 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.6490726818206927 [628] [575,339,580,369] -7 hSpCas9 negative selection 5772183
38318576 38318599 2 + 27260156 A375 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.798878177457088 [849] [632,609,552,498] -7 hSpCas9 negative selection 5836465
38318621 38318644 2 - 27260156 A375 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.3614470254513931 [531] [1057,779,909,479] 5 hSpCas9 negative selection 5836466
38318976 38318999 2 - 27260156 A375 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.027345175240272 [217] [138,155,77,129] -8 hSpCas9 negative selection 5836467
38343342 38343365 2 - 27260156 COLO741 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.6052566751247778 [674] [623,662,427] -8 hSpCas9 negative selection 5893432
38318964 38318987 2 + 27260156 COLO741 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -1.4690979620085627 [368] [214,111,185] -9 hSpCas9 negative selection 5893433
38343431 38343454 2 + 27260156 COLO741 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.7392604629723611 [628] [539,327,572] -9 hSpCas9 negative selection 5893434
38318576 38318599 2 + 27260156 COLO741 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -1.0584277969005624 [849] [640,575,367] -9 hSpCas9 negative selection 5957716
38318621 38318644 2 - 27260156 COLO741 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.17893739357619942 [531] [874,886,568] 4 hSpCas9 negative selection 5957717
38318976 38318999 2 - 27260156 COLO741 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.6179633712154775 [217] [59,83,122] -9 hSpCas9 negative selection 5957718
38343342 38343365 2 - 27260156 CAL120 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.4219446503386277 [674] [244,370,313] -9 hSpCas9 negative selection 6014683
38318964 38318987 2 + 27260156 CAL120 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.4517698657474295 [368] [502,125,401] -6 hSpCas9 negative selection 6014684
38343431 38343454 2 + 27260156 CAL120 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.628418482659971 [628] [456,583,470] -7 hSpCas9 negative selection 6014685
38318576 38318599 2 + 27260156 CAL120 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.5575882291025582 [849] [841,711,621] -7 hSpCas9 negative selection 6078967
38318621 38318644 2 - 27260156 CAL120 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.14537463895989255 [531] [830,694,685] 2 hSpCas9 negative selection 6078968
38318976 38318999 2 - 27260156 CAL120 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.4166110238220435 [217] [96,98,107] -9 hSpCas9 negative selection 6078969
38343342 38343365 2 - 27260156 CADOES1 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.45355930947528367 [674] [523,460,328,521] -7 hSpCas9 negative selection 6135934
38318964 38318987 2 + 27260156 CADOES1 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.17559288886805047 [368] [286,242,313,373] -3 hSpCas9 negative selection 6135935
38343431 38343454 2 + 27260156 CADOES1 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.4990806831724502 [628] [318,480,545,305] -7 hSpCas9 negative selection 6135936
38318576 38318599 2 + 27260156 CADOES1 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.3353958460792049 [849] [777,530,561,634] -5 hSpCas9 negative selection 6200218
38318621 38318644 2 - 27260156 CADOES1 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.4875704848240659 [531] [612,751,646,765] 7 hSpCas9 negative selection 6200219
38318976 38318999 2 - 27260156 CADOES1 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.06701851521547764 [217] [91,358,150,171] -1 hSpCas9 negative selection 6200220
38343342 38343365 2 - 27260156 EWS502 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.12293355004053763 [674] [577,618,725,716] -2 hSpCas9 negative selection 6257185
38318964 38318987 2 + 27260156 EWS502 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 0.06292854448452073 [368] [491,300,422,409] 1 hSpCas9 negative selection 6257186
38343431 38343454 2 + 27260156 EWS502 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.47037015879400995 [628] [448,462,548,464] -7 hSpCas9 negative selection 6257187
38318576 38318599 2 + 27260156 EWS502 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.32790599806529297 [849] [735,762,710,646] -5 hSpCas9 negative selection 6321469
38318621 38318644 2 - 27260156 EWS502 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.23599661202700312 [531] [555,764,724,611] 4 hSpCas9 negative selection 6321470
38318976 38318999 2 - 27260156 EWS502 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.3070563618469997 [217] [159,222,216,144] -5 hSpCas9 negative selection 6321471
38343342 38343365 2 - 27260156 EW8 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.3738958102444363 [674] [509,429,297,479] -6 hSpCas9 negative selection 6378436
38318964 38318987 2 + 27260156 EW8 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 0.027226203957596617 [368] [181,325,186,528] 0 hSpCas9 negative selection 6378437
38343431 38343454 2 + 27260156 EW8 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.4341456915719804 [628] [347,406,286,477] -7 hSpCas9 negative selection 6378438
38318576 38318599 2 + 27260156 EW8 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.3438353735964691 [849] [470,320,684,658] -6 hSpCas9 negative selection 6442720
38318621 38318644 2 - 27260156 EW8 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.3086461995965682 [531] [750,526,502,382] 5 hSpCas9 negative selection 6442721
38318976 38318999 2 - 27260156 EW8 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.28341810537299805 [217] [170,102,137,171] -5 hSpCas9 negative selection 6442722
38343342 38343365 2 - 27260156 CORL105 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.2120582450667759 [674] [766,717,786,475] -4 hSpCas9 negative selection 6499687
38318964 38318987 2 + 27260156 CORL105 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 0.35417777223666663 [368] [630,392,576,616] 6 hSpCas9 negative selection 6499688
38343431 38343454 2 + 27260156 CORL105 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.23602196438401588 [628] [785,508,820,423] -4 hSpCas9 negative selection 6499689
38318576 38318599 2 + 27260156 CORL105 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.33959013728780807 [849] [675,819,895,765] -6 hSpCas9 negative selection 6563971
38318621 38318644 2 - 27260156 CORL105 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.2564517095621729 [531] [705,725,978,600] 5 hSpCas9 negative selection 6563972
38318976 38318999 2 - 27260156 CORL105 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.05180225107191361 [217] [168,249,322,251] -1 hSpCas9 negative selection 6563973
38343342 38343365 2 - 27260156 HS294T viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.42058636503420654 [674] [141,116,293,241] -5 hSpCas9 negative selection 6620938
38318964 38318987 2 + 27260156 HS294T viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.23818845043431824 [368] [84,104,113,195] -3 hSpCas9 negative selection 6620939
38343431 38343454 2 + 27260156 HS294T viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.31198904575076136 [628] [171,267,140,202] -4 hSpCas9 negative selection 6620940
38318576 38318599 2 + 27260156 HS294T viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.5783456284696978 [849] [156,282,211,233] -7 hSpCas9 negative selection 6685222
38318621 38318644 2 - 27260156 HS294T viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.4109006879057398 [531] [299,195,248,362] 5 hSpCas9 negative selection 6685223
38318976 38318999 2 - 27260156 HS294T viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.5214162634741377 [217] [100,37,39,50] -6 hSpCas9 negative selection 6685224
38343342 38343365 2 - 27260156 HCC44 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.6357880624146345 [674] [456,393,578,554] -7 hSpCas9 negative selection 6742189
38318964 38318987 2 + 27260156 HCC44 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.17028152112812645 [368] [273,613,274,260] -3 hSpCas9 negative selection 6742190
38343431 38343454 2 + 27260156 HCC44 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.6349036128349613 [628] [719,365,451,330] -7 hSpCas9 negative selection 6742191
38318576 38318599 2 + 27260156 HCC44 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.3070728707926965 [849] [860,593,1100,639] -5 hSpCas9 negative selection 6806473
38318621 38318644 2 - 27260156 HCC44 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.18847457928979156 [531] [628,500,821,824] 3 hSpCas9 negative selection 6806474
38318976 38318999 2 - 27260156 HCC44 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.7827409550886792 [217] [102,115,237,131] -8 hSpCas9 negative selection 6806475
38343342 38343365 2 - 27260156 G402 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.6272342824908176 [674] [713,448,538,453] -6 hSpCas9 negative selection 6863440
38318964 38318987 2 + 27260156 G402 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.43548742675128127 [368] [202,563,264,294] -5 hSpCas9 negative selection 6863441
38343431 38343454 2 + 27260156 G402 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.38219508889474846 [628] [608,422,735,578] -5 hSpCas9 negative selection 6863442
38318576 38318599 2 + 27260156 G402 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.3313136841174701 [849] [926,611,642,1100] -4 hSpCas9 negative selection 6927724
38318621 38318644 2 - 27260156 G402 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.9393112885445372 [531] [1429,1385,1385,827] 9 hSpCas9 negative selection 6927725
38318976 38318999 2 - 27260156 G402 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.1434250999012385 [217] [100,80,107,182] -8 hSpCas9 negative selection 6927726
38343342 38343365 2 - 27260156 L33 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.10010588479642818 [674] [625,232,391,699] -2 hSpCas9 negative selection 6984691
38318964 38318987 2 + 27260156 L33 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.1333233487422842 [368] [300,180,148,365] -3 hSpCas9 negative selection 6984692
38343431 38343454 2 + 27260156 L33 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.23057075901579996 [628] [411,198,327,725] -5 hSpCas9 negative selection 6984693
38318576 38318599 2 + 27260156 L33 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.44773338063341006 [849] [518,257,458,616] -8 hSpCas9 negative selection 7048975
38318621 38318644 2 - 27260156 L33 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.28776527536205504 [531] [631,256,427,657] 6 hSpCas9 negative selection 7048976
38318976 38318999 2 - 27260156 L33 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.5933645756431289 [217] [152,71,77,124] -8 hSpCas9 negative selection 7048977
38343342 38343365 2 - 27260156 K562 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.4678496116447413 [674] [123,197,263,264] -9 hSpCas9 negative selection 7105942
38318964 38318987 2 + 27260156 K562 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.6602305418448754 [368] [105,317,217,185] -6 hSpCas9 negative selection 7105943
38343431 38343454 2 + 27260156 K562 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.8905168612394364 [628] [226,423,340,220] -7 hSpCas9 negative selection 7105944
38318576 38318599 2 + 27260156 K562 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.38396878620047764 [849] [666,618,745,317] -5 hSpCas9 negative selection 7170226
38318621 38318644 2 - 27260156 K562 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.28995346957500273 [531] [764,549,613,410] 3 hSpCas9 negative selection 7170227
38318976 38318999 2 - 27260156 K562 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.5731472237126929 [217] [99,28,68,62] -9 hSpCas9 negative selection 7170228
38343342 38343365 2 - 27260156 HT29 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.32940999686903805 [674] [717,576,739,579] -6 hSpCas9 negative selection 7227193
38318964 38318987 2 + 27260156 HT29 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.34500535876366256 [368] [360,330,347,366] -6 hSpCas9 negative selection 7227194
38343431 38343454 2 + 27260156 HT29 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.5469928981948667 [628] [631,561,408,500] -7 hSpCas9 negative selection 7227195
38318576 38318599 2 + 27260156 HT29 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.2104728977327215 [849] [995,948,818,822] -4 hSpCas9 negative selection 7291477
38318621 38318644 2 - 27260156 HT29 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.29321086426570403 [531] [955,915,592,729] 6 hSpCas9 negative selection 7291478
38318976 38318999 2 - 27260156 HT29 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.27683876781262584 [217] [315,159,218,184] -5 hSpCas9 negative selection 7291479
38343342 38343365 2 - 27260156 MHHES1 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.19132793343418752 [674] [695,869,683,468] -4 hSpCas9 negative selection 7348444
38318964 38318987 2 + 27260156 MHHES1 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.2411219297635896 [368] [232,521,289,354] -4 hSpCas9 negative selection 7348445
38343431 38343454 2 + 27260156 MHHES1 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.3333531983864918 [628] [608,588,590,475] -6 hSpCas9 negative selection 7348446
38318576 38318599 2 + 27260156 MHHES1 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.31623436424856377 [849] [752,851,868,624] -5 hSpCas9 negative selection 7412728
38318621 38318644 2 - 27260156 MHHES1 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.21603642734635015 [531] [928,642,762,501] 4 hSpCas9 negative selection 7412729
38318976 38318999 2 - 27260156 MHHES1 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.1010282342508868 [217] [223,194,245,238] -2 hSpCas9 negative selection 7412730
38343342 38343365 2 - 27260156 MEWO viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.487582852061917 [674] [440,507,399] -8 hSpCas9 negative selection 7469695
38318964 38318987 2 + 27260156 MEWO viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.641482368204398 [368] [207,280,171] -8 hSpCas9 negative selection 7469696
38343431 38343454 2 + 27260156 MEWO viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.9884328893756853 [628] [312,279,299] -9 hSpCas9 negative selection 7469697
38318576 38318599 2 + 27260156 MEWO viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.3152967871537453 [849] [747,493,696] -6 hSpCas9 negative selection 7533979
38318621 38318644 2 - 27260156 MEWO viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 -0.001747233200105336 [531] [494,461,533] 0 hSpCas9 negative selection 7533980
38318976 38318999 2 - 27260156 MEWO viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.6043438108602208 [217] [202,86,125] -8 hSpCas9 negative selection 7533981
38343342 38343365 2 - 27260156 LNCAPCLONEFGC viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.3585250138967233 [674] [358,432,614,525] -5 hSpCas9 negative selection 7590946
38318964 38318987 2 + 27260156 LNCAPCLONEFGC viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.21268971120328595 [368] [334,285,356,184] -3 hSpCas9 negative selection 7590947
38343431 38343454 2 + 27260156 LNCAPCLONEFGC viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.3225605323801758 [628] [436,510,516,362] -5 hSpCas9 negative selection 7590948
38318576 38318599 2 + 27260156 LNCAPCLONEFGC viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.36354791699325034 [849] [615,412,696,693] -5 hSpCas9 negative selection 7655230
38318621 38318644 2 - 27260156 LNCAPCLONEFGC viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.32784014870476524 [531] [610,584,555,660] 5 hSpCas9 negative selection 7655231
38318976 38318999 2 - 27260156 LNCAPCLONEFGC viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.36562038377353656 [217] [152,118,245,110] -5 hSpCas9 negative selection 7655232
38343342 38343365 2 - 27260156 PANC0327 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.7982433734140211 [674] [346,394,407,222] -8 hSpCas9 negative selection 7712197
38318964 38318987 2 + 27260156 PANC0327 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.8890761928253682 [368] [143,124,236,205] -8 hSpCas9 negative selection 7712198
38343431 38343454 2 + 27260156 PANC0327 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -1.2266010645236547 [628] [285,213,209,251] -9 hSpCas9 negative selection 7712199
38318576 38318599 2 + 27260156 PANC0327 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.8573280384194434 [849] [346,433,417,459] -8 hSpCas9 negative selection 7776481
38318621 38318644 2 - 27260156 PANC0327 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.28765918672473434 [531] [525,334,957,515] 4 hSpCas9 negative selection 7776482
38318976 38318999 2 - 27260156 PANC0327 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.5968462406318855 [217] [158,62,113,186] -7 hSpCas9 negative selection 7776483
38343342 38343365 2 - 27260156 NCIH2009 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.592607456928336 [674] [671,478,735] -6 hSpCas9 negative selection 7833448
38318964 38318987 2 + 27260156 NCIH2009 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.6380667409572245 [368] [410,277,320] -7 hSpCas9 negative selection 7833449
38343431 38343454 2 + 27260156 NCIH2009 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.28966048219838536 [628] [1068,598,558] -4 hSpCas9 negative selection 7833450
38318576 38318599 2 + 27260156 NCIH2009 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.4581478122834442 [849] [1182,582,893] -5 hSpCas9 negative selection 7897732
38318621 38318644 2 - 27260156 NCIH2009 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.3420163161366481 [531] [1130,1004,724] 5 hSpCas9 negative selection 7897733
38318976 38318999 2 - 27260156 NCIH2009 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.5928496174867983 [217] [222,127,259] -6 hSpCas9 negative selection 7897734
38343342 38343365 2 - 27260156 NCIH1373 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.9903135132824118 [674] [534,392,325,74] -7 hSpCas9 negative selection 7954699
38318964 38318987 2 + 27260156 NCIH1373 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.5565536667545866 [368] [219,311,411,40] -5 hSpCas9 negative selection 7954700
38343431 38343454 2 + 27260156 NCIH1373 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.7509713128615245 [628] [436,354,425,122] -6 hSpCas9 negative selection 7954701
38318576 38318599 2 + 27260156 NCIH1373 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.15858219391435713 [849] [888,1187,467,220] -1 hSpCas9 negative selection 8018983
38318621 38318644 2 - 27260156 NCIH1373 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.5947544612543361 [531] [814,525,1007,340] 6 hSpCas9 negative selection 8018984
38318976 38318999 2 - 27260156 NCIH1373 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.00872670950222365 [217] [258,126,167,116] 0 hSpCas9 negative selection 8018985
38343342 38343365 2 - 27260156 PATU8902 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.1006847095662313 [674] [203,639,201,813] -7 hSpCas9 negative selection 8075950
38318964 38318987 2 + 27260156 PATU8902 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.1870377684454283 [368] [432,597,434,325] -2 hSpCas9 negative selection 8075951
38343431 38343454 2 + 27260156 PATU8902 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.014237475948475964 [628] [752,1214,479,1151] 0 hSpCas9 negative selection 8075952
38318576 38318599 2 + 27260156 PATU8902 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -1.508415890861929 [849] [278,402,385,627] -8 hSpCas9 negative selection 8140234
38318621 38318644 2 - 27260156 PATU8902 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.4528419867646523 [531] [2016,974,366,820] 5 hSpCas9 negative selection 8140235
38318976 38318999 2 - 27260156 PATU8902 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.8367252465220323 [217] [59,398,115,112] -7 hSpCas9 negative selection 8140236
38343342 38343365 2 - 27260156 PANC1 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.2539789982076384 [674] [263,363,208,167] -9 hSpCas9 negative selection 8197201
38318964 38318987 2 + 27260156 PANC1 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -1.0498060699266203 [368] [136,168,144,160] -8 hSpCas9 negative selection 8197202
38343431 38343454 2 + 27260156 PANC1 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -1.115185481540962 [628] [159,464,263,164] -8 hSpCas9 negative selection 8197203
38318576 38318599 2 + 27260156 PANC1 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.7118748101719863 [849] [543,457,374,404] -7 hSpCas9 negative selection 8261485
38318621 38318644 2 - 27260156 PANC1 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.41920540168770287 [531] [550,976,545,460] 6 hSpCas9 negative selection 8261486
38318976 38318999 2 - 27260156 PANC1 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.0347643457544664 [217] [79,103,131,56] -8 hSpCas9 negative selection 8261487
38343342 38343365 2 - 27260156 PANC0813 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -1.0672064990486387 [674] [360,437,434,282] -8 hSpCas9 negative selection 8318452
38318964 38318987 2 + 27260156 PANC0813 viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.576464366779084 [368] [408,416,193,159] -7 hSpCas9 negative selection 8318453
38343431 38343454 2 + 27260156 PANC0813 viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.580199234547615 [628] [557,559,536,335] -7 hSpCas9 negative selection 8318454
38318576 38318599 2 + 27260156 PANC0813 viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.9425039974684132 [849] [562,485,628,409] -8 hSpCas9 negative selection 8382736
38318621 38318644 2 - 27260156 PANC0813 viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.31112150720673987 [531] [726,872,888,615] 5 hSpCas9 negative selection 8382737
38318976 38318999 2 - 27260156 PANC0813 viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -1.0088075074689842 [217] [209,185,64,58] -8 hSpCas9 negative selection 8382738
38343342 38343365 2 - 27260156 RDES viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.25924526635271467 [674] [618,634,606,729] -4 hSpCas9 negative selection 8439703
38318964 38318987 2 + 27260156 RDES viability CGCCATGTAAAGCCTGTCAATGG ATL2 ENSG00000119787 -0.03381221297516879 [368] [227,533,319,621] 0 hSpCas9 negative selection 8439704
38343431 38343454 2 + 27260156 RDES viability TGAGCAAGAACAATCTGTACTGG ATL2 ENSG00000119787 -0.19172578119505665 [628] [501,574,718,777] -3 hSpCas9 negative selection 8439705
38318576 38318599 2 + 27260156 RDES viability CACAGTCTTTGATAGTTGACTGG ATL2 ENSG00000119787 -0.3823653678852935 [849] [569,746,836,886] -6 hSpCas9 negative selection 8503987
38318621 38318644 2 - 27260156 RDES viability CTAGGTTGCTGTGCTGCTTATGG ATL2 ENSG00000119787 0.5093660630847279 [531] [904,815,696,1053] 7 hSpCas9 negative selection 8503988
38318976 38318999 2 - 27260156 RDES viability GGAAACAATGAACCATTGACAGG ATL2 ENSG00000119787 -0.47223619866016175 [217] [146,147,172,273] -7 hSpCas9 negative selection 8503989
38343342 38343365 2 - 27260156 PC3 viability ACGAGATCTTAACATAGTAGTGG ATL2 ENSG00000119787 -0.17713599050119627