Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 528
  • Symbol: ATP6V1C1
  • Description: ATPase H+ transporting V1 subunit C1
DataSource: http://genomecrispr.dkfz.de/#!/results/ATP6V1C1

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
103064709 103064732 8 + 26472758 Jiyoye viability TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.4303941535987383 [192] [26] -8 hSpCas9 negative selection 12596
103042360 103042383 8 + 26472758 Jiyoye viability GGTTGGCTTGTCAGATGAACTGG ATP6V1C1 ENSG00000155097 -2.5269366828376696 [106] [13] -9 hSpCas9 negative selection 12597
103040872 103040895 8 + 26472758 Jiyoye viability GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 1.160082519541101 [53] [90] 7 hSpCas9 negative selection 12598
103048934 103048957 8 + 26472758 Jiyoye viability GAGAATCTGTTGGCTAATGGAGG ATP6V1C1 ENSG00000155097 -2.228861303809552 [229] [36] -8 hSpCas9 negative selection 12599
103055864 103055887 8 + 26472758 Jiyoye viability GCAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 0.18678531308057342 [119] [102] 1 hSpCas9 negative selection 12600
103040887 103040910 8 + 26472758 Jiyoye viability AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 0.37219924326289877 [166] [162] 3 hSpCas9 negative selection 12601
103051069 103051092 8 + 26472758 Jiyoye viability AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 1.4544810962842303 [14] [30] 8 hSpCas9 negative selection 12602
103055895 103055918 8 + 26472758 Jiyoye viability GTATGAAACACTAGCCGAAATGG ATP6V1C1 ENSG00000155097 -2.463189338077531 [116] [15] -9 hSpCas9 negative selection 12603
103055874 103055897 8 - 26472758 Jiyoye viability ACTGCTTAATCCAGTCGTTGTGG ATP6V1C1 ENSG00000155097 -1.734180467739668 [224] [50] -8 hSpCas9 negative selection 12604
103064717 103064740 8 - 26472758 Jiyoye viability ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.3794209803849332 [137] [79] -3 hSpCas9 negative selection 12605
103064709 103064732 8 + 26472758 KBM7 viability TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.0309177554435323 [990,585] [251,110] -7 hSpCas9 negative selection 203714
103042360 103042383 8 + 26472758 KBM7 viability GGTTGGCTTGTCAGATGAACTGG ATP6V1C1 ENSG00000155097 0.03863680690885751 [267,230] [116,122] 0 hSpCas9 negative selection 203715
103040872 103040895 8 + 26472758 KBM7 viability GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 -0.2517128188862201 [249,390] [119,138] -2 hSpCas9 negative selection 203716
103048934 103048957 8 + 26472758 KBM7 viability GAGAATCTGTTGGCTAATGGAGG ATP6V1C1 ENSG00000155097 -0.9225382913526216 [751,634] [267,84] -6 hSpCas9 negative selection 203717
103055864 103055887 8 + 26472758 KBM7 viability GCAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -0.38142304914097497 [638,501] [262,151] -4 hSpCas9 negative selection 203718
103040887 103040910 8 + 26472758 KBM7 viability AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 0.10095255884243359 [1151,846] [609,398] 1 hSpCas9 negative selection 203719
103051069 103051092 8 + 26472758 KBM7 viability AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 0.2175097945313375 [239,376] [91,245] 2 hSpCas9 negative selection 203720
103055895 103055918 8 + 26472758 KBM7 viability GTATGAAACACTAGCCGAAATGG ATP6V1C1 ENSG00000155097 -0.4882437098187372 [438,242] [120,102] -4 hSpCas9 negative selection 203721
103055874 103055897 8 - 26472758 KBM7 viability ACTGCTTAATCCAGTCGTTGTGG ATP6V1C1 ENSG00000155097 -1.7264278623947966 [1120,978] [150,146] -8 hSpCas9 negative selection 203722
103064717 103064740 8 - 26472758 KBM7 viability ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.18330328329819928 [715,574] [357,182] -2 hSpCas9 negative selection 203723
103064709 103064732 8 + 26472758 Raji viability TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.5584989607311241 [494] [38] -8 hSpCas9 negative selection 394832
103042360 103042383 8 + 26472758 Raji viability GGTTGGCTTGTCAGATGAACTGG ATP6V1C1 ENSG00000155097 -0.6088234986258092 [137] [20] -5 hSpCas9 negative selection 394833
103040872 103040895 8 + 26472758 Raji viability GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 -0.10706013284735749 [180] [38] -1 hSpCas9 negative selection 394834
103048934 103048957 8 + 26472758 Raji viability GAGAATCTGTTGGCTAATGGAGG ATP6V1C1 ENSG00000155097 -3.1631454070071188 [385] [9] -9 hSpCas9 negative selection 394835
103055864 103055887 8 + 26472758 Raji viability GCAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -0.9462544282284739 [273] [32] -6 hSpCas9 negative selection 394836
103040887 103040910 8 + 26472758 Raji viability AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 -1.4257964232450104 [601] [51] -7 hSpCas9 negative selection 394837
103051069 103051092 8 + 26472758 Raji viability AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.04184247340087671 [172] [38] 0 hSpCas9 negative selection 394838
103055895 103055918 8 + 26472758 Raji viability GTATGAAACACTAGCCGAAATGG ATP6V1C1 ENSG00000155097 0.9165611930380214 [225] [98] 8 hSpCas9 negative selection 394839
103055874 103055897 8 - 26472758 Raji viability ACTGCTTAATCCAGTCGTTGTGG ATP6V1C1 ENSG00000155097 -1.7588650757375728 [524] [35] -8 hSpCas9 negative selection 394840
103064717 103064740 8 - 26472758 Raji viability ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -1.5248846801259135 [309] [24] -8 hSpCas9 negative selection 394841
103064709 103064732 8 + 26472758 K562 viability TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 0.025408945724651133 [709] [609] 0 hSpCas9 negative selection 585950
103042360 103042383 8 + 26472758 K562 viability GGTTGGCTTGTCAGATGAACTGG ATP6V1C1 ENSG00000155097 -2.5079220923866754 [282] [41] -8 hSpCas9 negative selection 585951
103040872 103040895 8 + 26472758 K562 viability GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 -1.784150424530324 [407] [99] -7 hSpCas9 negative selection 585952
103048934 103048957 8 + 26472758 K562 viability GAGAATCTGTTGGCTAATGGAGG ATP6V1C1 ENSG00000155097 -3.1653049717159294 [541] [50] -8 hSpCas9 negative selection 585953
103055864 103055887 8 + 26472758 K562 viability GCAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -1.758948123431952 [428] [106] -7 hSpCas9 negative selection 585954
103040887 103040910 8 + 26472758 K562 viability AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 -0.9928390432339248 [942] [399] -5 hSpCas9 negative selection 585955
103051069 103051092 8 + 26472758 K562 viability AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 0.4051127813755413 [330] [369] 3 hSpCas9 negative selection 585956
103055895 103055918 8 + 26472758 K562 viability GTATGAAACACTAGCCGAAATGG ATP6V1C1 ENSG00000155097 -0.6793456865064679 [257] [135] -4 hSpCas9 negative selection 585957
103055874 103055897 8 - 26472758 K562 viability ACTGCTTAATCCAGTCGTTGTGG ATP6V1C1 ENSG00000155097 -1.253411181328735 [770] [272] -6 hSpCas9 negative selection 585958
103064717 103064740 8 - 26472758 K562 viability ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 0.11997135674195825 [604] [554] 0 hSpCas9 negative selection 585959
103051069 103051092 8 + 26627737 DLD1 viability AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.38161463736808676 [856] [96,307,214] -4 hSpCas9 negative selection 837797
103051078 103051101 8 - 26627737 DLD1 viability GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -1.583366585167854 [107] [1,7,21] -8 hSpCas9 negative selection 837798
103064709 103064732 8 + 26627737 DLD1 viability TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -0.878430457060402 [230] [4,60,50] -7 hSpCas9 negative selection 837799
103064717 103064740 8 - 26627737 DLD1 viability ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.2847620811885176 [583] [221,142,92] -3 hSpCas9 negative selection 837800
103051069 103051092 8 + 26627737 GBM cells viability after 5 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 0.1179236568274813 [365] [217,207] 1 hSpCas9 negative selection 920112
103051078 103051101 8 - 26627737 GBM cells viability after 5 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -1.317404032041078 [78] [32,0] -9 hSpCas9 negative selection 920113
103064709 103064732 8 + 26627737 GBM cells viability after 5 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.6049770151881533 [172] [34,25] -9 hSpCas9 negative selection 920114
103064717 103064740 8 - 26627737 GBM cells viability after 5 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.8035922485371476 [523] [188,132] -8 hSpCas9 negative selection 920115
103051069 103051092 8 + 26627737 GBM cells viability after 13 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.40683037334226196 [365] [210,99] -5 hSpCas9 negative selection 1002427
103051078 103051101 8 - 26627737 GBM cells viability after 13 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -1.430322515887016 [78] [32,1] -9 hSpCas9 negative selection 1002428
103064709 103064732 8 + 26627737 GBM cells viability after 13 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -3.000647236656385 [172] [19,4] -9 hSpCas9 negative selection 1002429
103064717 103064740 8 - 26627737 GBM cells viability after 13 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -2.025526580961399 [523] [76,63] -9 hSpCas9 negative selection 1002430
103051069 103051092 8 + 26627737 GBM cells viability after 21 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.3974864961496953 [365] [151,149] -4 hSpCas9 negative selection 1084742
103051078 103051101 8 - 26627737 GBM cells viability after 21 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -4.114500644970814 [78] [2,1] -9 hSpCas9 negative selection 1084743
103064709 103064732 8 + 26627737 GBM cells viability after 21 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.1712666766969666 [172] [23,17] -9 hSpCas9 negative selection 1084744
103064717 103064740 8 - 26627737 GBM cells viability after 21 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -1.707301178174371 [523] [82,90] -8 hSpCas9 negative selection 1084745
103051069 103051092 8 + 26627737 RPE1 viability after 9 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.6352561968334701 [1501] [269,344] -4 hSpCas9 negative selection 1167057
103051078 103051101 8 - 26627737 RPE1 viability after 9 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -3.866180367481453 [308] [10,0] -9 hSpCas9 negative selection 1167058
103064709 103064732 8 + 26627737 RPE1 viability after 9 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.1274662492437426 [780] [65,42] -9 hSpCas9 negative selection 1167059
103064717 103064740 8 - 26627737 RPE1 viability after 9 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -1.5118589218317402 [1361] [190,95] -8 hSpCas9 negative selection 1167060
103051069 103051092 8 + 26627737 RPE1 viability after 12 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -2.0061213476426962 [1501] [47,155] -8 hSpCas9 negative selection 1249372
103051078 103051101 8 - 26627737 RPE1 viability after 12 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -4.375351616231237 [308] [3,3] -9 hSpCas9 negative selection 1249373
103064709 103064732 8 + 26627737 RPE1 viability after 12 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.4446757104655403 [780] [79,73] -7 hSpCas9 negative selection 1249374
103064717 103064740 8 - 26627737 RPE1 viability after 12 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -1.4731930162182438 [1361] [158,102] -7 hSpCas9 negative selection 1249375
103051069 103051092 8 + 26627737 RPE1 viability after 15 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -1.3860218539802402 [1501] [214,111] -7 hSpCas9 negative selection 1331687
103051078 103051101 8 - 26627737 RPE1 viability after 15 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -2.6162516191090486 [308] [27,0] -8 hSpCas9 negative selection 1331688
103064709 103064732 8 + 26627737 RPE1 viability after 15 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.867002905133376 [780] [84,36] -8 hSpCas9 negative selection 1331689
103064717 103064740 8 - 26627737 RPE1 viability after 15 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.9823313726267242 [1361] [137,249] -6 hSpCas9 negative selection 1331690
103051069 103051092 8 + 26627737 RPE1 viability after 18 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -1.4101784891666698 [1501] [152,151] -7 hSpCas9 negative selection 1414002
103051078 103051101 8 - 26627737 RPE1 viability after 18 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -6.3817947678036315 [308] [0,0] -9 hSpCas9 negative selection 1414003
103064709 103064732 8 + 26627737 RPE1 viability after 18 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.821536019930673 [780] [38,19] -9 hSpCas9 negative selection 1414004
103064717 103064740 8 - 26627737 RPE1 viability after 18 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -1.6106850631143537 [1361] [86,155] -7 hSpCas9 negative selection 1414005
103051069 103051092 8 + 26627737 HeLa viability after 8 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.013532708753821676 [488] [196,334,104] 0 hSpCas9 negative selection 1496317
103051078 103051101 8 - 26627737 HeLa viability after 8 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -1.7553375278685586 [59] [4,0,15] -9 hSpCas9 negative selection 1496318
103064709 103064732 8 + 26627737 HeLa viability after 8 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 0.7470432367444853 [106] [7,132,77] 6 hSpCas9 negative selection 1496319
103064717 103064740 8 - 26627737 HeLa viability after 8 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.18054882566139008 [833] [379,246,344] -2 hSpCas9 negative selection 1496320
103051069 103051092 8 + 26627737 HeLa viability after 12 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.7292701702412205 [488] [88,43,239] -6 hSpCas9 negative selection 1578632
103051078 103051101 8 - 26627737 HeLa viability after 12 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -1.548805626798682 [59] [0,0,23] -8 hSpCas9 negative selection 1578633
103064709 103064732 8 + 26627737 HeLa viability after 12 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -0.20976826570785168 [106] [0,62,46] -2 hSpCas9 negative selection 1578634
103064717 103064740 8 - 26627737 HeLa viability after 12 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.8509563580406556 [833] [173,169,230] -7 hSpCas9 negative selection 1578635
103051069 103051092 8 + 26627737 HeLa viability after 15 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.10347897294188607 [488] [97,297,158] -1 hSpCas9 negative selection 1660947
103051078 103051101 8 - 26627737 HeLa viability after 15 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -3.8609531854254477 [59] [0,2,0] -9 hSpCas9 negative selection 1660948
103064709 103064732 8 + 26627737 HeLa viability after 15 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.7975505430380445 [106] [0,8,28] -9 hSpCas9 negative selection 1660949
103064717 103064740 8 - 26627737 HeLa viability after 15 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.7907682946076013 [833] [254,148,182] -6 hSpCas9 negative selection 1660950
103051069 103051092 8 + 26627737 HeLa viability after 18 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.07477109164352994 [488] [67,252,158] 0 hSpCas9 negative selection 1743262
103051078 103051101 8 - 26627737 HeLa viability after 18 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -4.300151831646646 [59] [0,0,0] -9 hSpCas9 negative selection 1743263
103064709 103064732 8 + 26627737 HeLa viability after 18 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.7528371292849094 [106] [0,7,28] -9 hSpCas9 negative selection 1743264
103064717 103064740 8 - 26627737 HeLa viability after 18 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.7586186431450118 [833] [183,117,182] -6 hSpCas9 negative selection 1743265
103051069 103051092 8 + 26627737 HCT116 viability after 6 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -1.078517021588385 [1094] [212,8] -6 hSpCas9 negative selection 1825577
103051078 103051101 8 - 26627737 HCT116 viability after 6 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -0.27907524168334374 [100] [34,0] -1 hSpCas9 negative selection 1825578
103064709 103064732 8 + 26627737 HCT116 viability after 6 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 0.7167266191815068 [242] [172,1] 4 hSpCas9 negative selection 1825579
103064717 103064740 8 - 26627737 HCT116 viability after 6 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -1.1020353369446052 [1198] [159,47] -6 hSpCas9 negative selection 1825580
103051069 103051092 8 + 26627737 HCT116 viability after 8 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -0.9167401664664414 [730] [259,255,125] -8 hSpCas9 negative selection 1907892
103051078 103051101 8 - 26627737 HCT116 viability after 8 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 0.35847748252974343 [54] [52,39,23] 4 hSpCas9 negative selection 1907893
103064709 103064732 8 + 26627737 HCT116 viability after 8 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -0.6592950323206495 [167] [74,30,69] -7 hSpCas9 negative selection 1907894
103064717 103064740 8 - 26627737 HCT116 viability after 8 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 0.7397782075593601 [343] [334,302,311] 7 hSpCas9 negative selection 1907895
103051069 103051092 8 + 26627737 HCT116 viability after 9 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -1.3531460123422154 [1094] [71,147] -7 hSpCas9 negative selection 1990207
103051078 103051101 8 - 26627737 HCT116 viability after 9 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -2.098488892372996 [100] [12,0] -8 hSpCas9 negative selection 1990208
103064709 103064732 8 + 26627737 HCT116 viability after 9 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -1.2562962718149713 [242] [58,1] -7 hSpCas9 negative selection 1990209
103064717 103064740 8 - 26627737 HCT116 viability after 9 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -0.987517479073083 [1198] [94,213] -6 hSpCas9 negative selection 1990210
103051069 103051092 8 + 26627737 HCT116 viability after 12 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -1.3707974489772636 [730] [228,124,83] -8 hSpCas9 negative selection 2072522
103051078 103051101 8 - 26627737 HCT116 viability after 12 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -0.2804657127748551 [54] [14,16,39] -3 hSpCas9 negative selection 2072523
103064709 103064732 8 + 26627737 HCT116 viability after 12 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.4729412184864925 [167] [33,10,0] -9 hSpCas9 negative selection 2072524
103064717 103064740 8 - 26627737 HCT116 viability after 12 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 0.6468824913981143 [343] [116,415,333] 6 hSpCas9 negative selection 2072525
103051069 103051092 8 + 26627737 HCT116 viability after 15 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -1.1201879084592319 [730] [192,162,222] -8 hSpCas9 negative selection 2154837
103051078 103051101 8 - 26627737 HCT116 viability after 15 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -1.883496665427982 [54] [2,12,8] -9 hSpCas9 negative selection 2154838
103064709 103064732 8 + 26627737 HCT116 viability after 15 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.6957234634427625 [167] [32,8,4] -9 hSpCas9 negative selection 2154839
103064717 103064740 8 - 26627737 HCT116 viability after 15 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 0.4922727405070071 [343] [245,404,179] 4 hSpCas9 negative selection 2154840
103051069 103051092 8 + 26627737 HCT116 viability after 18 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -2.3329808212698637 [730] [110,56,41] -9 hSpCas9 negative selection 2237152
103051078 103051101 8 - 26627737 HCT116 viability after 18 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -2.052797360835241 [54] [0,1,16] -9 hSpCas9 negative selection 2237153
103064709 103064732 8 + 26627737 HCT116 viability after 18 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.024276514438439 [167] [46,7,4] -9 hSpCas9 negative selection 2237154
103064717 103064740 8 - 26627737 HCT116 viability after 18 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 0.11031346271907777 [343] [146,231,154] 1 hSpCas9 negative selection 2237155
103046351 103046374 8 - 25494202 A375 resistance to PLX-4720 (puromycin) TTAGCTGGGTGTGGTGGTGCAAG ATP6V1C1 ENSG00000155097 0.8185981808215854 [62,12] [14,13] 3 dCas9-VP64 positive selection 2474871
103046351 103046374 8 - 25494202 A375 resistance to PLX-4720 (zeocin) TTAGCTGGGTGTGGTGGTGCAAG ATP6V1C1 ENSG00000155097 0.3396219715193111 [78,56] [31,22] 2 dCas9-VP64 positive selection 2570126
103040888 103040911 8 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 0.16630796426010958 [4,5] [4,4] 3 hSpCas9 positive selection 2972503
103042387 103042410 8 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity AACTGGATGCATTTGTAGAAGGG ATP6V1C1 ENSG00000155097 -0.26976413510530767 [4,4] [4,1] -4 hSpCas9 positive selection 2972504
103040848 103040871 8 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity TCTGGCTTATATCTGCTCCTGGG ATP6V1C1 ENSG00000155097 -0.6377420349456128 [4,4] [4,0] -7 hSpCas9 positive selection 2972505
103051064 103051087 8 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity TTATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 0.08228964108602915 [4,4] [2,5] 1 hSpCas9 positive selection 2972506
103040888 103040911 8 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 -0.10197553823810512 [4,4] [4,1] -1 hSpCas9 positive selection 3040361
103042387 103042410 8 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity AACTGGATGCATTTGTAGAAGGG ATP6V1C1 ENSG00000155097 0.07134594055857643 [4,4] [2,3] 1 hSpCas9 positive selection 3040362
103040848 103040871 8 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity TCTGGCTTATATCTGCTCCTGGG ATP6V1C1 ENSG00000155097 0.16691668953068955 [4,4] [4,3] 3 hSpCas9 positive selection 3040363
103051064 103051087 8 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity TTATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -0.28154974181412923 [4,4] [3,1] -4 hSpCas9 positive selection 3040364
103052754 103052777 - 24336571 A375 resistance to PLX after 7 days ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 -0.2831307258683975 [12,8] [8,8] -8 hSpCas9 positive selection 3138383
103048924 103048947 + 24336571 A375 resistance to PLX after 7 days CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 0.494210710407493 [4,5] [7,6] 9 hSpCas9 positive selection 3138394
103048876 103048899 + 24336571 A375 resistance to PLX after 7 days TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 0.10447978874860886 [2,3] [2,2] 3 hSpCas9 positive selection 3138403
103052754 103052777 - 24336571 A375 resistance to PLX after 14 days ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 -0.8956790353234334 [15,7] [2,1] -9 hSpCas9 positive selection 3196176
103048924 103048947 + 24336571 A375 resistance to PLX after 14 days CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 1.3465249901688214 [4,3] [4,5] 8 hSpCas9 positive selection 3196187
103048876 103048899 + 24336571 A375 resistance to PLX after 14 days TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 0.07542704210900619 [3,3] [1,1] 0 hSpCas9 positive selection 3196196
103052754 103052777 - 24336571 A375 viability after 7 days ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.4168921899770678 [8] [12,8] 6 hSpCas9 negative selection 3253969
103048924 103048947 + 24336571 A375 viability after 7 days CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.42310485625788685 [7] [4,5] -6 hSpCas9 negative selection 3253980
103048876 103048899 + 24336571 A375 viability after 7 days TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.4619707375299984 [9] [2,3] -9 hSpCas9 negative selection 3253989
103052754 103052777 - 24336571 A375 viability after 14 days ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.5175380448386706 [8] [15,7] 6 hSpCas9 negative selection 3311762
103048924 103048947 + 24336571 A375 viability after 14 days CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.6361285366234358 [7] [4,3] -6 hSpCas9 negative selection 3311773
103048876 103048899 + 24336571 A375 viability after 14 days TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.0926293769718205 [9] [3,3] -8 hSpCas9 negative selection 3311782
103053947 103053970 8 + 27383988 293T resistance to West Nile virus (flavivirus) AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.609703191748191 [337,363] [0,5] 3 hSpCas9 positive selection 3338174
103052754 103052777 8 - 27383988 293T resistance to West Nile virus (flavivirus) ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 2.5862450279387654 [201,179] [0,13] 8 hSpCas9 positive selection 3338175
103048924 103048947 8 + 27383988 293T resistance to West Nile virus (flavivirus) CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 0.20964983280126245 [101,162] [0,0] 1 hSpCas9 positive selection 3338176
103048876 103048899 8 + 27383988 293T resistance to West Nile virus (flavivirus) TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 1.3504356158373165 [59,59] [0,0] 6 hSpCas9 positive selection 3357431
103052770 103052793 8 + 27383988 293T resistance to West Nile virus (flavivirus) TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -1.5596574118095456 [450,450] [0,0] -9 hSpCas9 positive selection 3357432
103053905 103053928 8 + 27383988 293T resistance to West Nile virus (flavivirus) TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.21293209208738176 [131,131] [0,0] 1 hSpCas9 positive selection 3357433
103040887 103040910 8 + 26780180 HT29 viability (Avana library 4 designs) AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 3.31239403787788 [] [] 8 hSpCas9 negative selection 3408654
103042386 103042409 8 + 26780180 HT29 viability (Avana library 4 designs) AACTGGATGCATTTGTAGAAGGG ATP6V1C1 ENSG00000155097 5.01790654678537 [] [] 9 hSpCas9 negative selection 3408655
103040847 103040870 8 + 26780180 HT29 viability (Avana library 4 designs) TCTGGCTTATATCTGCTCCTGGG ATP6V1C1 ENSG00000155097 1.71057656202633 [] [] 6 hSpCas9 negative selection 3408656
103051063 103051086 8 + 26780180 HT29 viability (Avana library 4 designs) TTATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 3.80413136836952 [] [] 9 hSpCas9 negative selection 3408657
103040887 103040910 8 + 26780180 A375 viability (Avana lentiCRISPRv2) AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 -1.38828294198922 [] [] -2 hSpCas9 negative selection 3482298
103051063 103051086 8 + 26780180 A375 viability (Avana lentiCRISPRv2) TTATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -27.977323144385 [] [] -9 hSpCas9 negative selection 3482299
103042386 103042409 8 + 26780180 A375 viability (Avana lentiCRISPRv2) AACTGGATGCATTTGTAGAAGGG ATP6V1C1 ENSG00000155097 1.89706204644077 [] [] 2 hSpCas9 negative selection 3482300
103040847 103040870 8 + 26780180 A375 viability (Avana lentiCRISPRv2) TCTGGCTTATATCTGCTCCTGGG ATP6V1C1 ENSG00000155097 0.911374279329271 [] [] 1 hSpCas9 negative selection 3482301
103051053 103051076 8 + 26780180 A375 viability (Avana lentiCRISPRv2) ACTTGGTTACTTATATAACAAGG ATP6V1C1 ENSG00000155097 -10.2214451939714 [] [] -7 hSpCas9 negative selection 3482302
103040872 103040895 8 + 26780180 A375 viability (Avana lentiCRISPRv2) GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 -4.42851021039074 [] [] -5 hSpCas9 negative selection 3482303
103040887 103040910 8 + 26780180 A375 viability (Avana lentiGuide) AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 5.40624439934344 [] [] 5 hSpCas9 negative selection 3590957
103051063 103051086 8 + 26780180 A375 viability (Avana lentiGuide) TTATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 16.5182967565062 [] [] 8 hSpCas9 negative selection 3590958
103042386 103042409 8 + 26780180 A375 viability (Avana lentiGuide) AACTGGATGCATTTGTAGAAGGG ATP6V1C1 ENSG00000155097 16.6330756426952 [] [] 8 hSpCas9 negative selection 3590959
103040847 103040870 8 + 26780180 A375 viability (Avana lentiGuide) TCTGGCTTATATCTGCTCCTGGG ATP6V1C1 ENSG00000155097 6.51689554082525 [] [] 5 hSpCas9 negative selection 3590960
103051053 103051076 8 + 26780180 A375 viability (Avana lentiGuide) ACTTGGTTACTTATATAACAAGG ATP6V1C1 ENSG00000155097 6.83079442965624 [] [] 5 hSpCas9 negative selection 3590961
103040872 103040895 8 + 26780180 A375 viability (Avana lentiGuide) GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 3.99236357681461 [] [] 4 hSpCas9 negative selection 3590962
103040887 103040910 8 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 -0.031668391143398644 [6] [6,5] 0 hSpCas9 positive selection 3699616
103051063 103051086 8 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) TTATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -1.2477870107601312 [9] [5,1] -9 hSpCas9 positive selection 3699617
103042386 103042409 8 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AACTGGATGCATTTGTAGAAGGG ATP6V1C1 ENSG00000155097 0.03423546082533191 [6] [7,6] 0 hSpCas9 positive selection 3699618
103040847 103040870 8 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) TCTGGCTTATATCTGCTCCTGGG ATP6V1C1 ENSG00000155097 0.06421928191659229 [6] [6,5] 1 hSpCas9 positive selection 3699619
103051053 103051076 8 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ACTTGGTTACTTATATAACAAGG ATP6V1C1 ENSG00000155097 -1.128285123907577 [9] [3,3] -9 hSpCas9 positive selection 3699620
103040872 103040895 8 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 -0.545195910505174 [5] [2,3] -7 hSpCas9 positive selection 3699621
103040887 103040910 8 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AACATGGGAGAAATTGCATGCGG ATP6V1C1 ENSG00000155097 -0.10784966452621467 [7] [4,5] -1 hSpCas9 positive selection 3808223
103051063 103051086 8 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) TTATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -0.7429371266434918 [7] [1,4] -7 hSpCas9 positive selection 3808224
103042386 103042409 8 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AACTGGATGCATTTGTAGAAGGG ATP6V1C1 ENSG00000155097 -0.24937513511060655 [6] [5,2] -3 hSpCas9 positive selection 3808225
103040847 103040870 8 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) TCTGGCTTATATCTGCTCCTGGG ATP6V1C1 ENSG00000155097 0.03840181946464938 [6] [5,5] 0 hSpCas9 positive selection 3808226
103051053 103051076 8 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ACTTGGTTACTTATATAACAAGG ATP6V1C1 ENSG00000155097 -0.5078670812090099 [5] [2,2] -6 hSpCas9 positive selection 3808227
103040872 103040895 8 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GAAAACCTGTCAGCAAACATGGG ATP6V1C1 ENSG00000155097 -0.7094126846465562 [5] [0,3] -7 hSpCas9 positive selection 3808228
103053947 103053970 8 + 26780180 A375 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.569596934224554 [] [] 1 hSpCas9 negative selection 3916474
103052754 103052777 8 - 26780180 A375 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.454022214991246 [] [] 1 hSpCas9 negative selection 3916475
103048924 103048947 8 + 26780180 A375 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 1.32604396021409 [] [] 7 hSpCas9 negative selection 3916476
103048876 103048899 8 + 26780180 A375 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 1.66749265504103 [] [] 9 hSpCas9 negative selection 3916477
103053905 103053928 8 + 26780180 A375 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 1.66358254854697 [] [] 8 hSpCas9 negative selection 3916478
103052770 103052793 8 + 26780180 A375 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 1.10854146360922 [] [] 5 hSpCas9 negative selection 3916479
103053947 103053970 8 + 26780180 HT29 viability (GeCKOv2 library) AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.896206020486564 [] [] 4 hSpCas9 negative selection 4024440
103052754 103052777 8 - 26780180 HT29 viability (GeCKOv2 library) ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.527345672361075 [] [] 1 hSpCas9 negative selection 4024441
103048924 103048947 8 + 26780180 HT29 viability (GeCKOv2 library) CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 1.77922709006334 [] [] 8 hSpCas9 negative selection 4024442
103048876 103048899 8 + 26780180 HT29 viability (GeCKOv2 library) TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 1.81081700568667 [] [] 8 hSpCas9 negative selection 4024443
103053905 103053928 8 + 26780180 HT29 viability (GeCKOv2 library) TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 1.67606131640903 [] [] 8 hSpCas9 negative selection 4024444
103052770 103052793 8 + 26780180 HT29 viability (GeCKOv2 library) TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 1.5974058895551 [] [] 8 hSpCas9 negative selection 4024445
103052754 103052777 8 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 -0.3349079043087181 [3] [2,1] -7 hSpCas9 positive selection 4163609
103048924 103048947 8 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.24312187230432628 [3] [0,2] -5 hSpCas9 positive selection 4163620
103048876 103048899 8 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 0.10453607323803049 [1] [1,0] 2 hSpCas9 positive selection 4163631
103052754 103052777 8 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.9866734310378207 [3] [4,0,0,4] 7 hSpCas9 positive selection 4227631
103048924 103048947 8 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 0.2023222687906846 [1] [0,0,2,0] 1 hSpCas9 positive selection 4227642
103048876 103048899 8 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 0.5115130725524734 [2] [0,2,5,0] 3 hSpCas9 positive selection 4227653
103053947 103053970 8 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.48013597432160776 [4] [4,4] 8 hSpCas9 positive selection 4257440
103052754 103052777 8 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.3678256069003456 [3] [3,3] 7 hSpCas9 positive selection 4257441
103048924 103048947 8 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.38660486550609136 [3] [2,0] -7 hSpCas9 positive selection 4257442
103048876 103048899 8 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.7686082943437995 [2] [1,0] -9 hSpCas9 positive selection 4321724
103052770 103052793 8 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 0.1603924837843359 [4] [3,3] 3 hSpCas9 positive selection 4321725
103053905 103053928 8 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.28106951079358955 [2] [2,0] -5 hSpCas9 positive selection 4321726
103042331 103042353 8 + 27760321 OCIAML3 viability TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -0.3797583099059315 [385,398] [167,326] -4 hSpCas9 negative selection 4380677
103042370 103042392 8 + 27760321 OCIAML3 viability TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -0.5158673305480571 [251,226] [129,131] -5 hSpCas9 negative selection 4380678
103051064 103051086 8 + 27760321 OCIAML3 viability TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 0.023918642799904077 [3,11] [0,13] 0 hSpCas9 negative selection 4380679
103055865 103055887 8 + 27760321 OCIAML3 viability CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -0.4758411754545346 [744,590] [391,348] -5 hSpCas9 negative selection 4380680
103055923 103055945 8 - 27760321 OCIAML3 viability CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -0.27391181740437 [0,1] [0,0] -3 hSpCas9 negative selection 4380681
103042331 103042353 8 + 27760321 OCIAML2 viability TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -0.724641570969633 [385,398] [145,254] -6 hSpCas9 negative selection 4464140
103042370 103042392 8 + 27760321 OCIAML2 viability TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -0.46687285894294506 [251,226] [133,147] -5 hSpCas9 negative selection 4464141
103051064 103051086 8 + 27760321 OCIAML2 viability TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -2.7567195076300184 [3,11] [0,0] -9 hSpCas9 negative selection 4464142
103055865 103055887 8 + 27760321 OCIAML2 viability CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -1.1036994157170272 [744,590] [201,312] -8 hSpCas9 negative selection 4464143
103055923 103055945 8 - 27760321 OCIAML2 viability CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -0.3226571826694187 [0,1] [0,0] -4 hSpCas9 negative selection 4464144
103042331 103042353 8 + 27760321 MV411 viability TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 0.4006716910703797 [385,398] [239,498] 3 hSpCas9 negative selection 4547603
103042370 103042392 8 + 27760321 MV411 viability TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -2.1827344211623 [251,226] [5,77] -8 hSpCas9 negative selection 4547604
103051064 103051086 8 + 27760321 MV411 viability TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -2.4628955734502878 [3,11] [0,0] -9 hSpCas9 negative selection 4547605
103055865 103055887 8 + 27760321 MV411 viability CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -2.208355624753774 [744,590] [87,104] -8 hSpCas9 negative selection 4547606
103055923 103055945 8 - 27760321 MV411 viability CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -0.028833248489688046 [0,1] [0,0] 0 hSpCas9 negative selection 4547607
103042331 103042353 8 + 27760321 HL60 viability TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -0.23348000418388887 [385,398] [289,256] -3 hSpCas9 negative selection 4631066
103042370 103042392 8 + 27760321 HL60 viability TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 0.05393294537987425 [251,226] [248,153] 0 hSpCas9 negative selection 4631067
103051064 103051086 8 + 27760321 HL60 viability TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -0.15790494727273607 [3,11] [9,1] -2 hSpCas9 negative selection 4631068
103055865 103055887 8 + 27760321 HL60 viability CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -0.6359929824154447 [744,590] [347,349] -6 hSpCas9 negative selection 4631069
103055923 103055945 8 - 27760321 HL60 viability CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -0.33670341028382467 [0,1] [0,0] -4 hSpCas9 negative selection 4631070
103042331 103042353 8 + 27760321 HT1080 viability TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -4.6166082131617205 [398,311] [0,10] -8 hSpCas9 negative selection 4714529
103042370 103042392 8 + 27760321 HT1080 viability TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -2.2742351908094713 [226,176] [29,1] -6 hSpCas9 negative selection 4714530
103051064 103051086 8 + 27760321 HT1080 viability TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -2.137477237836361 [11,9] [0,0] -6 hSpCas9 negative selection 4714531
103055865 103055887 8 + 27760321 HT1080 viability CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -7.711052758975358 [590,460] [0,0] -9 hSpCas9 negative selection 4714532
103055923 103055945 8 - 27760321 HT1080 viability CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 0.30562769391905587 [1,1] [0,0] 1 hSpCas9 negative selection 4714533
103042331 103042353 8 + 27760321 HT29 viability after 7 days TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -0.5679686404082378 [398,311] [275,334,308] -7 hSpCas9 negative selection 4797992
103042370 103042392 8 + 27760321 HT29 viability after 7 days TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -0.2263980357567681 [226,176] [180,231,245] -3 hSpCas9 negative selection 4797993
103051064 103051086 8 + 27760321 HT29 viability after 7 days TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -2.7840883959646314 [11,9] [0,1,2] -9 hSpCas9 negative selection 4797994
103055865 103055887 8 + 27760321 HT29 viability after 7 days CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -0.41405833292685956 [590,460] [577,384,566] -6 hSpCas9 negative selection 4797995
103055923 103055945 8 - 27760321 HT29 viability after 7 days CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -1.3840325596302083 [1,1] [0,0,0] -9 hSpCas9 negative selection 4797996
103042331 103042353 8 + 27760321 HT29 viability after 25 days TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -4.1587251422664275 [398,311] [14,36,15] -9 hSpCas9 negative selection 4881455
103042370 103042392 8 + 27760321 HT29 viability after 25 days TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -6.564912860624328 [226,176] [4,0,0] -9 hSpCas9 negative selection 4881456
103051064 103051086 8 + 27760321 HT29 viability after 25 days TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -2.163071708752195 [11,9] [0,0,6] -8 hSpCas9 negative selection 4881457
103055865 103055887 8 + 27760321 HT29 viability after 25 days CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -6.15886474744099 [590,460] [6,3,14] -9 hSpCas9 negative selection 4881458
103055923 103055945 8 - 27760321 HT29 viability after 25 days CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -1.214054570927468 [1,1] [0,0,0] -7 hSpCas9 negative selection 4881459
103042331 103042353 8 + 27760321 HT29 viability after 22 days TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -3.0498523224233636 [398,311] [46,48,52] -8 hSpCas9 negative selection 4964918
103042370 103042392 8 + 27760321 HT29 viability after 22 days TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -7.13916741277683 [226,176] [0,0,2] -9 hSpCas9 negative selection 4964919
103051064 103051086 8 + 27760321 HT29 viability after 22 days TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -3.6744781345421442 [11,9] [0,0,0] -9 hSpCas9 negative selection 4964920
103055865 103055887 8 + 27760321 HT29 viability after 22 days CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -9.24805365568114 [590,460] [0,0,0] -9 hSpCas9 negative selection 4964921
103055923 103055945 8 - 27760321 HT29 viability after 22 days CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -1.2313732027867275 [1,1] [0,0,0] -7 hSpCas9 negative selection 4964922
103042331 103042353 8 + 27760321 HT29 viability after 19 days TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -3.9342981801553614 [398,311] [1,69,5] -9 hSpCas9 negative selection 5048381
103042370 103042392 8 + 27760321 HT29 viability after 19 days TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -7.851471959498131 [226,176] [0,0,0] -9 hSpCas9 negative selection 5048382
103051064 103051086 8 + 27760321 HT29 viability after 19 days TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -3.2213760482976044 [11,9] [0,0,1] -9 hSpCas9 negative selection 5048383
103055865 103055887 8 + 27760321 HT29 viability after 19 days CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -8.058280674752798 [590,460] [3,1,0] -9 hSpCas9 negative selection 5048384
103055923 103055945 8 - 27760321 HT29 viability after 19 days CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -1.2155331503635143 [1,1] [0,0,0] -7 hSpCas9 negative selection 5048385
103042331 103042353 8 + 27760321 HT29 viability after 16 days TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -1.9981986070345654 [398,311] [122,95,81] -8 hSpCas9 negative selection 5131844
103042370 103042392 8 + 27760321 HT29 viability after 16 days TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -6.5785186226726635 [226,176] [0,0,4] -9 hSpCas9 negative selection 5131845
103051064 103051086 8 + 27760321 HT29 viability after 16 days TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -3.6271736296980093 [11,9] [0,0,0] -9 hSpCas9 negative selection 5131846
103055865 103055887 8 + 27760321 HT29 viability after 16 days CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -6.617111126486 [590,460] [6,8,1] -9 hSpCas9 negative selection 5131847
103055923 103055945 8 - 27760321 HT29 viability after 16 days CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -1.1840686979425925 [1,1] [0,0,0] -7 hSpCas9 negative selection 5131848
103042331 103042353 8 + 27760321 HT29 viability after 13 days TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -3.1480916822264944 [398,311] [65,34,38] -9 hSpCas9 negative selection 5215307
103042370 103042392 8 + 27760321 HT29 viability after 13 days TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -4.548430158985538 [226,176] [0,17,10] -9 hSpCas9 negative selection 5215308
103051064 103051086 8 + 27760321 HT29 viability after 13 days TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -3.6794610291421472 [11,9] [0,0,0] -9 hSpCas9 negative selection 5215309
103055865 103055887 8 + 27760321 HT29 viability after 13 days CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -3.35731810651984 [590,460] [91,68,19] -9 hSpCas9 negative selection 5215310
103055923 103055945 8 - 27760321 HT29 viability after 13 days CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -1.2363560973867305 [1,1] [0,0,0] -8 hSpCas9 negative selection 5215311
103042331 103042353 8 + 27760321 HT29 viability after 10 days TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -1.3609251817460897 [398,311] [222,80,210] -8 hSpCas9 negative selection 5298770
103042370 103042392 8 + 27760321 HT29 viability after 10 days TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -2.8135671758510794 [226,176] [81,22,2] -9 hSpCas9 negative selection 5298771
103051064 103051086 8 + 27760321 HT29 viability after 10 days TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -3.785472336302491 [11,9] [0,0,0] -9 hSpCas9 negative selection 5298772
103055865 103055887 8 + 27760321 HT29 viability after 10 days CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -2.738652575826257 [590,460] [96,195,6] -9 hSpCas9 negative selection 5298773
103055923 103055945 8 - 27760321 HT29 viability after 10 days CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 -1.3423674045470744 [1,1] [0,0,0] -8 hSpCas9 negative selection 5298774
103042331 103042353 8 + 27760321 MOLM13 viability TCCTTTTAGGTTGGCACGTTGG ATP6V1C1 ENSG00000155097 -0.19798738930337906 [385,398] [39,324] -1 hSpCas9 negative selection 5382233
103042370 103042392 8 + 27760321 MOLM13 viability TCAGATGAACTGGCTAAACTGG ATP6V1C1 ENSG00000155097 -0.07742708376615359 [251,226] [74,172] 0 hSpCas9 negative selection 5382234
103051064 103051086 8 + 27760321 MOLM13 viability TATATAACAAGGTTCCAGTGGG ATP6V1C1 ENSG00000155097 -2.2368387606226925 [3,11] [0,0] -8 hSpCas9 negative selection 5382235
103055865 103055887 8 + 27760321 MOLM13 viability CAGGTTAAACCACAACGACTGG ATP6V1C1 ENSG00000155097 -0.9010207801904313 [744,590] [212,189] -5 hSpCas9 negative selection 5382236
103055923 103055945 8 - 27760321 MOLM13 viability CTACTTACTTGCTAGACCTTGG ATP6V1C1 ENSG00000155097 0.19722356433790722 [0,1] [0,0] 1 hSpCas9 negative selection 5382237
103021078 103021101 8 + 27661255 K562 viability GACTTGTTCTGTGTTCGCTTGGG ATP6V1C1 ENSG00000155097 -0.07088019015438007 [385,375] [358,230] -3 dCas9-KRAB negative selection 5464313
103021112 103021135 8 + 27661255 K562 viability GTGAGGCCGGAGCTTAGGTCGGG ATP6V1C1 ENSG00000155097 -1.9704771884272905 [1213,1396] [306,229] -9 dCas9-KRAB negative selection 5464314
103021116 103021139 8 + 27661255 K562 viability GGCCGGAGCTTAGGTCGGGAAGG ATP6V1C1 ENSG00000155097 -2.0418538874985566 [1213,1034] [275,169] -9 dCas9-KRAB negative selection 5464315
103021541 103021564 8 + 27661255 K562 viability GGGAATGAAGTGATAGGTCCAGG ATP6V1C1 ENSG00000155097 -0.19438449686642334 [711,547] [490,399] -6 dCas9-KRAB negative selection 5464316
103021153 103021176 8 - 27661255 K562 viability GACAGCCTAGCGGACGCTATCGG ATP6V1C1 ENSG00000155097 -1.1310083692408426 [923,1090] [401,335] -8 dCas9-KRAB negative selection 5464317
103053947 103053970 8 + 27260156 BXPC3 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.0526475063772327 [1112] [1010,1056,1156,1292] -1 hSpCas9 negative selection 5529900
103052754 103052777 8 - 27260156 BXPC3 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.44497822189573955 [639] [834,928,842,1053] 8 hSpCas9 negative selection 5529901
103048924 103048947 8 + 27260156 BXPC3 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.4277386185244432 [478] [314,301,391,504] -7 hSpCas9 negative selection 5529902
103048876 103048899 8 + 27260156 BXPC3 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.248158493303016 [237] [105,79,96,140] -9 hSpCas9 negative selection 5594184
103052770 103052793 8 + 27260156 BXPC3 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.27499061567554595 [1221] [1016,1066,1057,1080] -6 hSpCas9 negative selection 5594185
103053905 103053928 8 + 27260156 BXPC3 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.3099847786850073 [320] [449,330,388,502] 6 hSpCas9 negative selection 5594186
103053947 103053970 8 + 27260156 A673 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.06650041013477259 [1112] [1333,1194,1185,1403] -2 hSpCas9 negative selection 5651151
103052754 103052777 8 - 27260156 A673 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.327377190746033 [639] [912,855,1021,1065] 7 hSpCas9 negative selection 5651152
103048924 103048947 8 + 27260156 A673 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.2960851971551511 [478] [631,472,434,344] -6 hSpCas9 negative selection 5651153
103048876 103048899 8 + 27260156 A673 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.0560127453316672 [237] [204,124,105,120] -9 hSpCas9 negative selection 5715435
103052770 103052793 8 + 27260156 A673 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.3568742999400718 [1221] [1047,1182,1234,1098] -7 hSpCas9 negative selection 5715436
103053905 103053928 8 + 27260156 A673 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.2106348389576257 [320] [278,355,291,401] -5 hSpCas9 negative selection 5715437
103053947 103053970 8 + 27260156 A375 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.3646715468766899 [1112] [1814,2046,1448,1456] 5 hSpCas9 negative selection 5772402
103052754 103052777 8 - 27260156 A375 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.5495645064660359 [639] [1097,1385,1095,860] 7 hSpCas9 negative selection 5772403
103048924 103048947 8 + 27260156 A375 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.769587735426365 [478] [362,341,237,365] -7 hSpCas9 negative selection 5772404
103048876 103048899 8 + 27260156 A375 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.9164088869610147 [237] [79,95,89,35] -9 hSpCas9 negative selection 5836686
103052770 103052793 8 + 27260156 A375 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.49308691737597354 [1221] [1125,821,1262,836] -6 hSpCas9 negative selection 5836687
103053905 103053928 8 + 27260156 A375 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.3750159830511405 [320] [583,649,361,382] 5 hSpCas9 negative selection 5836688
103053947 103053970 8 + 27260156 COLO741 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.18252739043931876 [1112] [1346,1021,1384] -4 hSpCas9 negative selection 5893653
103052754 103052777 8 - 27260156 COLO741 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.3788464534503071 [639] [1107,1030,1052] 7 hSpCas9 negative selection 5893654
103048924 103048947 8 + 27260156 COLO741 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.2603974379810141 [478] [559,495,481] -5 hSpCas9 negative selection 5893655
103048876 103048899 8 + 27260156 COLO741 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.2501970528904625 [237] [137,172,76] -9 hSpCas9 negative selection 5957937
103052770 103052793 8 + 27260156 COLO741 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.4431324417193331 [1221] [1363,1232,883] -7 hSpCas9 negative selection 5957938
103053905 103053928 8 + 27260156 COLO741 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.42656579362982805 [320] [284,362,267] -7 hSpCas9 negative selection 5957939
103053947 103053970 8 + 27260156 CAL120 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.533170546149623 [1112] [2260,1978,1813] 7 hSpCas9 negative selection 6014904
103052754 103052777 8 - 27260156 CAL120 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.41030943270291 [639] [953,1310,896] 6 hSpCas9 negative selection 6014905
103048924 103048947 8 + 27260156 CAL120 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.7370482355184266 [478] [338,322,406] -8 hSpCas9 negative selection 6014906
103048876 103048899 8 + 27260156 CAL120 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -2.012177973159033 [237] [53,16,144] -9 hSpCas9 negative selection 6079188
103052770 103052793 8 + 27260156 CAL120 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.2740705619184287 [1221] [1318,1128,1331] -4 hSpCas9 negative selection 6079189
103053905 103053928 8 + 27260156 CAL120 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.338484534826181 [320] [590,602,336] 5 hSpCas9 negative selection 6079190
103053947 103053970 8 + 27260156 CADOES1 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.04409721865204186 [1112] [1017,986,876,1138] 0 hSpCas9 negative selection 6136155
103052754 103052777 8 - 27260156 CADOES1 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.44090736006981224 [639] [626,615,1053,939] 7 hSpCas9 negative selection 6136156
103048924 103048947 8 + 27260156 CADOES1 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.7305942936678703 [478] [351,228,265,224] -8 hSpCas9 negative selection 6136157
103048876 103048899 8 + 27260156 CADOES1 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.5065809348446868 [237] [83,51,85,89] -9 hSpCas9 negative selection 6200439
103052770 103052793 8 + 27260156 CADOES1 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.38065639898367987 [1221] [829,955,886,816] -6 hSpCas9 negative selection 6200440
103053905 103053928 8 + 27260156 CADOES1 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.43380374733577803 [320] [401,424,335,451] 7 hSpCas9 negative selection 6200441
103053947 103053970 8 + 27260156 EWS502 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.2908344280336157 [1112] [1173,1702,1293,1624] 5 hSpCas9 negative selection 6257406
103052754 103052777 8 - 27260156 EWS502 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.4001831433919284 [639] [741,904,942,1011] 7 hSpCas9 negative selection 6257407
103048924 103048947 8 + 27260156 EWS502 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.8894359214921499 [478] [216,246,248,397] -8 hSpCas9 negative selection 6257408
103048876 103048899 8 + 27260156 EWS502 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.6920466216800347 [237] [103,37,80,87] -9 hSpCas9 negative selection 6321690
103052770 103052793 8 + 27260156 EWS502 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.48528667652878443 [1221] [734,1001,933,1052] -7 hSpCas9 negative selection 6321691
103053905 103053928 8 + 27260156 EWS502 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.1572148646165008 [320] [284,379,245,305] -3 hSpCas9 negative selection 6321692
103053947 103053970 8 + 27260156 EW8 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.05543550015783438 [1112] [1250,997,795,760] 1 hSpCas9 negative selection 6378657
103052754 103052777 8 - 27260156 EW8 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.30105986732970924 [639] [585,780,562,631] 5 hSpCas9 negative selection 6378658
103048924 103048947 8 + 27260156 EW8 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.061469336689683934 [478] [314,462,294,420] -1 hSpCas9 negative selection 6378659
103048876 103048899 8 + 27260156 EW8 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.43025040711652385 [237] [251,147,67,128] -7 hSpCas9 negative selection 6442941
103052770 103052793 8 + 27260156 EW8 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.27011291561730655 [1221] [980,806,697,834] -5 hSpCas9 negative selection 6442942
103053905 103053928 8 + 27260156 EW8 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.08834366095815915 [320] [542,256,170,181] 1 hSpCas9 negative selection 6442943
103053947 103053970 8 + 27260156 CORL105 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.09625606570010614 [1112] [1160,1231,1239,1242] -2 hSpCas9 negative selection 6499908
103052754 103052777 8 - 27260156 CORL105 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.32110717783841813 [639] [901,974,1105,785] 6 hSpCas9 negative selection 6499909
103048924 103048947 8 + 27260156 CORL105 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.4974153552247259 [478] [573,399,218,373] -7 hSpCas9 negative selection 6499910
103048876 103048899 8 + 27260156 CORL105 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.119888471912123 [237] [99,125,129,155] -9 hSpCas9 negative selection 6564192
103052770 103052793 8 + 27260156 CORL105 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.7706110402879169 [1221] [793,763,929,879] -8 hSpCas9 negative selection 6564193
103053905 103053928 8 + 27260156 CORL105 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.06217611678889512 [320] [355,333,391,362] -1 hSpCas9 negative selection 6564194
103053947 103053970 8 + 27260156 HS294T viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.15691389650216414 [1112] [433,480,461,557] 2 hSpCas9 negative selection 6621159
103052754 103052777 8 - 27260156 HS294T viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.5176002543354912 [639] [218,391,275,577] 7 hSpCas9 negative selection 6621160
103048924 103048947 8 + 27260156 HS294T viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.499005910083931 [478] [85,115,123,216] -6 hSpCas9 negative selection 6621161
103048876 103048899 8 + 27260156 HS294T viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.4505960577168533 [237] [12,22,51,51] -9 hSpCas9 negative selection 6685443
103052770 103052793 8 + 27260156 HS294T viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.38787787627873516 [1221] [262,280,407,531] -5 hSpCas9 negative selection 6685444
103053905 103053928 8 + 27260156 HS294T viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.14757105745084198 [320] [121,148,129,151] 2 hSpCas9 negative selection 6685445
103053947 103053970 8 + 27260156 HCC44 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.6048157768632143 [1112] [1640,1614,2281,2175] 8 hSpCas9 negative selection 6742410
103052754 103052777 8 - 27260156 HCC44 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.50496543312998 [639] [947,1054,1297,840] 8 hSpCas9 negative selection 6742411
103048924 103048947 8 + 27260156 HCC44 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.9012602114395708 [478] [234,231,277,409] -8 hSpCas9 negative selection 6742412
103048876 103048899 8 + 27260156 HCC44 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.0379835858236903 [237] [201,150,66,96] -8 hSpCas9 negative selection 6806694
103052770 103052793 8 + 27260156 HCC44 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.2859745383336536 [1221] [1103,1149,1028,1215] -4 hSpCas9 negative selection 6806695
103053905 103053928 8 + 27260156 HCC44 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.03178237329486466 [320] [451,278,455,330] 0 hSpCas9 negative selection 6806696
103053947 103053970 8 + 27260156 G402 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.12428691021134175 [1112] [1495,1675,1234,1519] 1 hSpCas9 negative selection 6863661
103052754 103052777 8 - 27260156 G402 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.6181262689441627 [639] [1717,1065,1188,898] 7 hSpCas9 negative selection 6863662
103048924 103048947 8 + 27260156 G402 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.5952537438469964 [478] [1074,95,356,113] -6 hSpCas9 negative selection 6863663
103048876 103048899 8 + 27260156 G402 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -2.6881659343021864 [237] [73,41,63,5] -9 hSpCas9 negative selection 6927945
103052770 103052793 8 + 27260156 G402 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.5843776016173091 [1221] [1265,907,1026,815] -6 hSpCas9 negative selection 6927946
103053905 103053928 8 + 27260156 G402 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.2849795142106934 [320] [441,472,345,632] 3 hSpCas9 negative selection 6927947
103053947 103053970 8 + 27260156 L33 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.04456016821753361 [1112] [1138,454,818,1040] 1 hSpCas9 negative selection 6984912
103052754 103052777 8 - 27260156 L33 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.21788229922601177 [639] [726,316,424,799] 5 hSpCas9 negative selection 6984913
103048924 103048947 8 + 27260156 L33 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 0.3659852159855009 [478] [572,299,372,571] 7 hSpCas9 negative selection 6984914
103048876 103048899 8 + 27260156 L33 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.8188615536488777 [237] [95,64,71,170] -9 hSpCas9 negative selection 7049196
103052770 103052793 8 + 27260156 L33 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.007267090833172896 [1221] [1179,494,758,1267] 0 hSpCas9 negative selection 7049197
103053905 103053928 8 + 27260156 L33 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.12516967001062945 [320] [350,158,206,331] 2 hSpCas9 negative selection 7049198
103053947 103053970 8 + 27260156 K562 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.3910965850425623 [1112] [1676,993,1375,1159] 5 hSpCas9 negative selection 7106163
103052754 103052777 8 - 27260156 K562 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.7900514693892198 [639] [873,924,713,1354] 8 hSpCas9 negative selection 7106164
103048924 103048947 8 + 27260156 K562 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.3614265741855964 [478] [382,229,385,322] -4 hSpCas9 negative selection 7106165
103048876 103048899 8 + 27260156 K562 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.134348188877526 [237] [96,148,32,106] -8 hSpCas9 negative selection 7170447
103052770 103052793 8 + 27260156 K562 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.4025619499974442 [1221] [455,924,1054,817] -5 hSpCas9 negative selection 7170448
103053905 103053928 8 + 27260156 K562 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.6672298471397976 [320] [537,188,755,331] 8 hSpCas9 negative selection 7170449
103053947 103053970 8 + 27260156 HT29 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.28875581175040566 [1112] [1886,1665,1706,1390] 5 hSpCas9 negative selection 7227414
103052754 103052777 8 - 27260156 HT29 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.5134947895207959 [639] [1302,1301,1050,842] 8 hSpCas9 negative selection 7227415
103048924 103048947 8 + 27260156 HT29 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.8988325866468437 [478] [322,419,282,239] -8 hSpCas9 negative selection 7227416
103048876 103048899 8 + 27260156 HT29 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.1707707075916536 [237] [126,162,88,135] -9 hSpCas9 negative selection 7291698
103052770 103052793 8 + 27260156 HT29 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.7203229555588059 [1221] [1080,963,958,646] -8 hSpCas9 negative selection 7291699
103053905 103053928 8 + 27260156 HT29 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.22458976030963235 [320] [538,544,433,331] 4 hSpCas9 negative selection 7291700
103053947 103053970 8 + 27260156 MHHES1 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.2149762410110292 [1112] [1386,855,1235,878] -4 hSpCas9 negative selection 7348665
103052754 103052777 8 - 27260156 MHHES1 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.43193816256209416 [639] [1154,1191,853,759] 7 hSpCas9 negative selection 7348666
103048924 103048947 8 + 27260156 MHHES1 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.1665371320012173 [478] [763,602,286,336] -3 hSpCas9 negative selection 7348667
103048876 103048899 8 + 27260156 MHHES1 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.41108069820076265 [237] [173,215,193,212] -6 hSpCas9 negative selection 7412949
103052770 103052793 8 + 27260156 MHHES1 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.11915209285689543 [1221] [1755,1297,1170,950] -2 hSpCas9 negative selection 7412950
103053905 103053928 8 + 27260156 MHHES1 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.15399489852709547 [320] [376,441,234,268] -3 hSpCas9 negative selection 7412951
103053947 103053970 8 + 27260156 MEWO viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.07770570581242109 [1112] [1127,1026,831] -2 hSpCas9 negative selection 7469916
103052754 103052777 8 - 27260156 MEWO viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.18521984948018688 [639] [808,688,568] 4 hSpCas9 negative selection 7469917
103048924 103048947 8 + 27260156 MEWO viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.3884652085310249 [478] [331,334,357] -7 hSpCas9 negative selection 7469918
103048876 103048899 8 + 27260156 MEWO viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.5917078050332136 [237] [54,63,98] -9 hSpCas9 negative selection 7534200
103052770 103052793 8 + 27260156 MEWO viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.506326790169067 [1221] [912,880,640] -8 hSpCas9 negative selection 7534201
103053905 103053928 8 + 27260156 MEWO viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.1925204631512769 [320] [357,217,230] -4 hSpCas9 negative selection 7534202
103053947 103053970 8 + 27260156 LNCAPCLONEFGC viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.493889256989124 [1112] [1429,1274,1738,1290] 7 hSpCas9 negative selection 7591167
103052754 103052777 8 - 27260156 LNCAPCLONEFGC viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.5913808414818174 [639] [1065,656,994,803] 8 hSpCas9 negative selection 7591168
103048924 103048947 8 + 27260156 LNCAPCLONEFGC viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.6623173851297075 [478] [214,381,290,204] -7 hSpCas9 negative selection 7591169
103048876 103048899 8 + 27260156 LNCAPCLONEFGC viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.7798446428101802 [237] [92,86,22,39] -9 hSpCas9 negative selection 7655451
103052770 103052793 8 + 27260156 LNCAPCLONEFGC viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.42552592186604565 [1221] [737,873,792,884] -6 hSpCas9 negative selection 7655452
103053905 103053928 8 + 27260156 LNCAPCLONEFGC viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.11701956526218826 [320] [265,333,315,344] 1 hSpCas9 negative selection 7655453
103053947 103053970 8 + 27260156 PANC0327 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.15632584781756553 [1112] [903,1002,949,1545] 2 hSpCas9 negative selection 7712418
103052754 103052777 8 - 27260156 PANC0327 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.5472416351054888 [639] [797,902,896,712] 7 hSpCas9 negative selection 7712419
103048924 103048947 8 + 27260156 PANC0327 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.9981542511299224 [478] [118,153,283,294] -8 hSpCas9 negative selection 7712420
103048876 103048899 8 + 27260156 PANC0327 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.8181642181295317 [237] [68,207,83,102] -8 hSpCas9 negative selection 7776702
103052770 103052793 8 + 27260156 PANC0327 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.3788865966277152 [1221] [745,514,992,1118] -5 hSpCas9 negative selection 7776703
103053905 103053928 8 + 27260156 PANC0327 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.2816382775999146 [320] [485,198,420,310] 4 hSpCas9 negative selection 7776704
103053947 103053970 8 + 27260156 NCIH2009 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.16864504873899078 [1112] [1455,1406,1298] -2 hSpCas9 negative selection 7833669
103052754 103052777 8 - 27260156 NCIH2009 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.4126329596710463 [639] [1519,1240,871] 5 hSpCas9 negative selection 7833670
103048924 103048947 8 + 27260156 NCIH2009 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -1.3501315448801738 [478] [231,320,226] -8 hSpCas9 negative selection 7833671
103048876 103048899 8 + 27260156 NCIH2009 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.6115638451616656 [237] [111,157,55] -9 hSpCas9 negative selection 7897953
103052770 103052793 8 + 27260156 NCIH2009 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.6748661626808534 [1221] [1702,670,964] -7 hSpCas9 negative selection 7897954
103053905 103053928 8 + 27260156 NCIH2009 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.3026304462117396 [320] [629,372,673] 4 hSpCas9 negative selection 7897955
103053947 103053970 8 + 27260156 NCIH1373 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.5017807385409983 [1112] [1944,1749,1942,373] 5 hSpCas9 negative selection 7954920
103052754 103052777 8 - 27260156 NCIH1373 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 1.0838991881006022 [639] [1802,1460,1233,430] 9 hSpCas9 negative selection 7954921
103048924 103048947 8 + 27260156 NCIH1373 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.7410758469418325 [478] [802,188,146,60] -6 hSpCas9 negative selection 7954922
103048876 103048899 8 + 27260156 NCIH1373 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -2.932742774553228 [237] [18,86,5,4] -9 hSpCas9 negative selection 8019204
103052770 103052793 8 + 27260156 NCIH1373 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.561647002440345 [1221] [1203,568,828,316] -5 hSpCas9 negative selection 8019205
103053905 103053928 8 + 27260156 NCIH1373 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.21675837653748098 [320] [341,359,383,154] 2 hSpCas9 negative selection 8019206
103053947 103053970 8 + 27260156 PATU8902 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.5733910163775053 [1112] [1073,1448,694,1029] -5 hSpCas9 negative selection 8076171
103052754 103052777 8 - 27260156 PATU8902 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.9568180642406192 [639] [1688,1596,1971,1565] 9 hSpCas9 negative selection 8076172
103048924 103048947 8 + 27260156 PATU8902 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -1.019732404360767 [478] [247,546,285,233] -7 hSpCas9 negative selection 8076173
103048876 103048899 8 + 27260156 PATU8902 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.6092678045262676 [237] [149,13,156,97] -8 hSpCas9 negative selection 8140455
103052770 103052793 8 + 27260156 PATU8902 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.6508445944440348 [1221] [911,1108,764,1699] -6 hSpCas9 negative selection 8140456
103053905 103053928 8 + 27260156 PATU8902 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.1806708497800743 [320] [192,431,353,637] -2 hSpCas9 negative selection 8140457
103053947 103053970 8 + 27260156 PANC1 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.19507168282833098 [1112] [836,1280,1370,941] 3 hSpCas9 negative selection 8197422
103052754 103052777 8 - 27260156 PANC1 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.4769715828811091 [639] [706,1028,728,655] 7 hSpCas9 negative selection 8197423
103048924 103048947 8 + 27260156 PANC1 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -1.514525667177376 [478] [120,219,134,117] -9 hSpCas9 negative selection 8197424
103048876 103048899 8 + 27260156 PANC1 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -2.5113855053175556 [237] [53,23,39,23] -9 hSpCas9 negative selection 8261706
103052770 103052793 8 + 27260156 PANC1 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.38610903252875894 [1221] [835,1005,624,775] -6 hSpCas9 negative selection 8261707
103053905 103053928 8 + 27260156 PANC1 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.17136570234619197 [320] [250,220,317,189] -3 hSpCas9 negative selection 8261708
103053947 103053970 8 + 27260156 PANC0813 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.1940643741168011 [1112] [1179,1230,1220,951] -3 hSpCas9 negative selection 8318673
103052754 103052777 8 - 27260156 PANC0813 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.6633839948809814 [639] [1308,1259,1325,893] 9 hSpCas9 negative selection 8318674
103048924 103048947 8 + 27260156 PANC0813 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.9813890023954632 [478] [491,194,354,125] -8 hSpCas9 negative selection 8318675
103048876 103048899 8 + 27260156 PANC0813 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -2.105653208820958 [237] [94,82,31,52] -9 hSpCas9 negative selection 8382957
103052770 103052793 8 + 27260156 PANC0813 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.4588749530398194 [1221] [867,1163,1092,1034] -6 hSpCas9 negative selection 8382958
103053905 103053928 8 + 27260156 PANC0813 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.07283243128703232 [320] [393,335,422,287] -1 hSpCas9 negative selection 8382959
103053947 103053970 8 + 27260156 RDES viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.10293864528300323 [1112] [1281,1043,1468,1776] 1 hSpCas9 negative selection 8439924
103052754 103052777 8 - 27260156 RDES viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.7000374227861361 [639] [968,1048,1471,1354] 9 hSpCas9 negative selection 8439925
103048924 103048947 8 + 27260156 RDES viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.6959450176238556 [478] [329,348,215,469] -8 hSpCas9 negative selection 8439926
103048876 103048899 8 + 27260156 RDES viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.2792208919625303 [237] [136,109,112,75] -9 hSpCas9 negative selection 8504208
103052770 103052793 8 + 27260156 RDES viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.578617654602294 [1221] [787,897,984,1131] -7 hSpCas9 negative selection 8504209
103053905 103053928 8 + 27260156 RDES viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.07434784299893826 [320] [215,326,353,559] -1 hSpCas9 negative selection 8504210
103053947 103053970 8 + 27260156 PC3 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.12367124647111694 [1112] [916,953,1872,1359] 2 hSpCas9 negative selection 8561175
103052754 103052777 8 - 27260156 PC3 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.2935822336027216 [639] [687,468,1362,791] 6 hSpCas9 negative selection 8561176
103048924 103048947 8 + 27260156 PC3 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.028376477908567795 [478] [336,421,717,502] 0 hSpCas9 negative selection 8561177
103048876 103048899 8 + 27260156 PC3 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.019980308146205 [237] [34,119,222,162] -9 hSpCas9 negative selection 8625459
103052770 103052793 8 + 27260156 PC3 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.08079436868313716 [1221] [708,1150,2045,1131] -2 hSpCas9 negative selection 8625460
103053905 103053928 8 + 27260156 PC3 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.10149381990385703 [320] [275,317,473,344] 2 hSpCas9 negative selection 8625461
103053947 103053970 8 + 27260156 PATU8988T viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.3259621121629108 [1112] [1033,1381,1319,1686] 5 hSpCas9 negative selection 8682426
103052754 103052777 8 - 27260156 PATU8988T viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.42712000675126394 [639] [887,907,753,779] 7 hSpCas9 negative selection 8682427
103048924 103048947 8 + 27260156 PATU8988T viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.38484625750391904 [478] [313,389,294,428] -6 hSpCas9 negative selection 8682428
103048876 103048899 8 + 27260156 PATU8988T viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.3856644743840307 [237] [85,155,50,63] -9 hSpCas9 negative selection 8746710
103052770 103052793 8 + 27260156 PATU8988T viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.27772245441957466 [1221] [701,929,1521,708] -5 hSpCas9 negative selection 8746711
103053905 103053928 8 + 27260156 PATU8988T viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 -0.20687034353167244 [320] [377,287,167,241] -4 hSpCas9 negative selection 8746712
103053947 103053970 8 + 27260156 T47D viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.188211246906562 [1112] [1646,1338,1535,1395] 4 hSpCas9 negative selection 8803677
103052754 103052777 8 - 27260156 T47D viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.3984992655556465 [639] [981,923,1044,983] 8 hSpCas9 negative selection 8803678
103048924 103048947 8 + 27260156 T47D viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.2906039623313881 [478] [374,498,532,410] -6 hSpCas9 negative selection 8803679
103048876 103048899 8 + 27260156 T47D viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.67489502226922 [237] [235,136,180,142] -8 hSpCas9 negative selection 8867961
103052770 103052793 8 + 27260156 T47D viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.07780561972597111 [1221] [1324,1249,1365,1465] -2 hSpCas9 negative selection 8867962
103053905 103053928 8 + 27260156 T47D viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.3644838714858283 [320] [459,429,451,591] 7 hSpCas9 negative selection 8867963
103053947 103053970 8 + 27260156 SU8686 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.34810937034306555 [1112] [1225,1293,1326,1868] 6 hSpCas9 negative selection 8924928
103052754 103052777 8 - 27260156 SU8686 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.5130502959303125 [639] [747,694,1151,1104] 8 hSpCas9 negative selection 8924929
103048924 103048947 8 + 27260156 SU8686 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.9128358127551234 [478] [227,208,188,413] -8 hSpCas9 negative selection 8924930
103048876 103048899 8 + 27260156 SU8686 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -2.1016301345322903 [237] [30,77,62,45] -9 hSpCas9 negative selection 8989212
103052770 103052793 8 + 27260156 SU8686 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.7476443608058694 [1221] [737,687,671,795] -8 hSpCas9 negative selection 8989213
103053905 103053928 8 + 27260156 SU8686 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.004434799915213228 [320] [247,371,288,374] 0 hSpCas9 negative selection 8989214
103053947 103053970 8 + 27260156 SKES1 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.1798039915715337 [1112] [1343,1124,1330,1216] 4 hSpCas9 negative selection 9046179
103052754 103052777 8 - 27260156 SKES1 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.3389487841646419 [639] [827,789,814,790] 7 hSpCas9 negative selection 9046180
103048924 103048947 8 + 27260156 SKES1 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.2502003889573898 [478] [466,372,348,417] -5 hSpCas9 negative selection 9046181
103048876 103048899 8 + 27260156 SKES1 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.1359265917094221 [237] [137,101,120,76] -9 hSpCas9 negative selection 9110463
103052770 103052793 8 + 27260156 SKES1 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.35748919487911124 [1221] [909,1088,1109,722] -7 hSpCas9 negative selection 9110464
103053905 103053928 8 + 27260156 SKES1 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.17431936246451746 [320] [329,539,307,289] 4 hSpCas9 negative selection 9110465
103053947 103053970 8 + 27260156 TOV112D viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.04019557258856099 [1112] [1386,1048,1238,910] 0 hSpCas9 negative selection 9167430
103052754 103052777 8 - 27260156 TOV112D viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.4435074998958578 [639] [829,962,720,986] 7 hSpCas9 negative selection 9167431
103048924 103048947 8 + 27260156 TOV112D viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.20917976673964495 [478] [586,299,362,395] -4 hSpCas9 negative selection 9167432
103048876 103048899 8 + 27260156 TOV112D viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.9796442535716767 [237] [90,153,124,118] -9 hSpCas9 negative selection 9231714
103052770 103052793 8 + 27260156 TOV112D viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.25482765667782514 [1221] [1021,864,990,1178] -5 hSpCas9 negative selection 9231715
103053905 103053928 8 + 27260156 TOV112D viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.22186836369160906 [320] [526,384,247,354] 4 hSpCas9 negative selection 9231716
103053947 103053970 8 + 27260156 TC71 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 0.20162219430944872 [1112] [1202,1317,1377,1606] 5 hSpCas9 negative selection 9288681
103052754 103052777 8 - 27260156 TC71 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.1888611348932504 [639] [740,815,675,906] 5 hSpCas9 negative selection 9288682
103048924 103048947 8 + 27260156 TC71 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 0.2303691392262149 [478] [507,604,717,574] 5 hSpCas9 negative selection 9288683
103048876 103048899 8 + 27260156 TC71 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -0.49123280016828375 [237] [137,216,156,217] -8 hSpCas9 negative selection 9352965
103052770 103052793 8 + 27260156 TC71 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.14660238034716344 [1221] [1045,1172,1095,1439] -4 hSpCas9 negative selection 9352966
103053905 103053928 8 + 27260156 TC71 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.23790738225116592 [320] [356,419,400,448] 6 hSpCas9 negative selection 9352967
103053947 103053970 8 + 27260156 TC32 viability AGAGTATCTCGTCACATTACTGG ATP6V1C1 ENSG00000155097 -0.03530242814879192 [1112] [886,648,1474,1264] 0 hSpCas9 negative selection 9409932
103052754 103052777 8 - 27260156 TC32 viability ATGCAGATGCTCGAGATTTCAGG ATP6V1C1 ENSG00000155097 0.6179488021414548 [639] [763,895,1132,905] 9 hSpCas9 negative selection 9409933
103048924 103048947 8 + 27260156 TC32 viability CAAAGTTCAAGAGAATCTGTTGG ATP6V1C1 ENSG00000155097 -0.6150277257555837 [478] [291,176,420,337] -8 hSpCas9 negative selection 9409934
103048876 103048899 8 + 27260156 TC32 viability TAAGAAAGTAGCTCAATACATGG ATP6V1C1 ENSG00000155097 -1.027346831714113 [237] [107,37,161,164] -9 hSpCas9 negative selection 9474216
103052770 103052793 8 + 27260156 TC32 viability TCTGCATACAATAACCTGAAAGG ATP6V1C1 ENSG00000155097 -0.2353102469050905 [1221] [943,771,1330,935] -4 hSpCas9 negative selection 9474217
103053905 103053928 8 + 27260156 TC32 viability TCTAGCAGAAATTGTGAAGAAGG ATP6V1C1 ENSG00000155097 0.33914131127432995 [320] [359,323,550,317] 6 hSpCas9 negative selection 9474218
103051069 103051092 8 + 27869803 HPAFII viability after 27 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097 -3.5123549886357965 [293] [18,8,NaN] -9 hSpCas9 negative selection 9600901
103051078 103051101 8 - 27869803 HPAFII viability after 27 days GATATTTGGCCATGTCCCACTGG ATP6V1C1 ENSG00000155097 -3.531851164261594 [69] [0,4,NaN] -9 hSpCas9 negative selection 9600902
103064709 103064732 8 + 27869803 HPAFII viability after 27 days TATAGGGACCACTTGTACGGTGG ATP6V1C1 ENSG00000155097 -2.040462778852635 [137] [21,13,NaN] -8 hSpCas9 negative selection 9600903
103064717 103064740 8 - 27869803 HPAFII viability after 27 days ACTTTCAGCCACCGTACAAGTGG ATP6V1C1 ENSG00000155097 -1.2352612647668872 [470] [108,101,NaN] -7 hSpCas9 negative selection 9600904
103051069 103051092 8 + 27869803 HPAFII viability after 15 days AACAAGGTTCCAGTGGGACATGG ATP6V1C1 ENSG00000155097