Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 91949
  • Symbol: Cog7
  • Description: component of oligomeric golgi complex 7
DataSource: http://genomecrispr.dkfz.de/#!/results/Cog7

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
23424870 23424893 16 + 26472758 Jiyoye viability GGAGGGCAGCGAGGGCATGAGGG COG7 ENSG00000168434 1.2551722880608236 [49] [89] 7 hSpCas9 negative selection 34863
23442528 23442551 16 - 26472758 Jiyoye viability GGAGGCACTGAAGAACAGGCTGG COG7 ENSG00000168434 -0.6859340228856081 [31] [14] -5 hSpCas9 negative selection 34864
23424911 23424934 16 + 26472758 Jiyoye viability GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 -0.19338397426630127 [278] [183] -1 hSpCas9 negative selection 34865
23424777 23424800 16 + 26472758 Jiyoye viability GCCCTTGGCGAAGTGGGCGGTGG COG7 ENSG00000168434 -1.5824826742726674 [138] [34] -7 hSpCas9 negative selection 34866
23418792 23418815 16 - 26472758 Jiyoye viability GGTAAAAGTCACGGAGCTGGTGG COG7 ENSG00000168434 -0.8664726983527723 [190] [78] -6 hSpCas9 negative selection 34867
23406151 23406174 16 - 26472758 Jiyoye viability AGAACTCTGCCAAGAACCCATGG COG7 ENSG00000168434 -0.8292648143162074 [171] [72] -5 hSpCas9 negative selection 34868
23398061 23398084 16 + 26472758 Jiyoye viability GAGAGGGGTGAGACTAAAGGCGG COG7 ENSG00000168434 0.13868654557997173 [52] [43] 1 hSpCas9 negative selection 34869
23424870 23424893 16 + 26472758 KBM7 viability GGAGGGCAGCGAGGGCATGAGGG COG7 ENSG00000168434 -0.2971943381243773 [431,368] [109,190] -3 hSpCas9 negative selection 225981
23442528 23442551 16 - 26472758 KBM7 viability GGAGGCACTGAAGAACAGGCTGG COG7 ENSG00000168434 0.22837337867216911 [77,55] [55,18] 2 hSpCas9 negative selection 225982
23424911 23424934 16 + 26472758 KBM7 viability GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 0.1317375265345675 [1201,840] [787,278] 1 hSpCas9 negative selection 225983
23424777 23424800 16 + 26472758 KBM7 viability GCCCTTGGCGAAGTGGGCGGTGG COG7 ENSG00000168434 -0.24075865024668408 [116,101] [24,59] -2 hSpCas9 negative selection 225984
23418792 23418815 16 - 26472758 KBM7 viability GGTAAAAGTCACGGAGCTGGTGG COG7 ENSG00000168434 0.3738623207732565 [443,290] [196,240] 4 hSpCas9 negative selection 225985
23406151 23406174 16 - 26472758 KBM7 viability AGAACTCTGCCAAGAACCCATGG COG7 ENSG00000168434 -1.233631119841815 [460,373] [101,65] -7 hSpCas9 negative selection 225986
23398061 23398084 16 + 26472758 KBM7 viability GAGAGGGGTGAGACTAAAGGCGG COG7 ENSG00000168434 -0.7489624995148797 [391,405] [76,143] -6 hSpCas9 negative selection 225987
23424870 23424893 16 + 26472758 Raji viability GGAGGGCAGCGAGGGCATGAGGG COG7 ENSG00000168434 -0.3300217769336989 [194] [35] -3 hSpCas9 negative selection 417099
23442528 23442551 16 - 26472758 Raji viability GGAGGCACTGAAGAACAGGCTGG COG7 ENSG00000168434 0.3418487890106223 [50] [14] 3 hSpCas9 negative selection 417100
23424911 23424934 16 + 26472758 Raji viability GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 1.2295894677467705 [361] [196] 9 hSpCas9 negative selection 417101
23424777 23424800 16 + 26472758 Raji viability GCCCTTGGCGAAGTGGGCGGTGG COG7 ENSG00000168434 0.6923460360947558 [31] [11] 6 hSpCas9 negative selection 417102
23418792 23418815 16 - 26472758 Raji viability GGTAAAAGTCACGGAGCTGGTGG COG7 ENSG00000168434 0.24168462708519056 [163] [44] 2 hSpCas9 negative selection 417103
23406151 23406174 16 - 26472758 Raji viability AGAACTCTGCCAAGAACCCATGG COG7 ENSG00000168434 0.23589827589627976 [321] [87] 2 hSpCas9 negative selection 417104
23398061 23398084 16 + 26472758 Raji viability GAGAGGGGTGAGACTAAAGGCGG COG7 ENSG00000168434 0.6118561182343878 [171] [60] 6 hSpCas9 negative selection 417105
23424870 23424893 16 + 26472758 K562 viability GGAGGGCAGCGAGGGCATGAGGG COG7 ENSG00000168434 -0.02888401362117418 [422] [349] 0 hSpCas9 negative selection 608217
23442528 23442551 16 - 26472758 K562 viability GGAGGCACTGAAGAACAGGCTGG COG7 ENSG00000168434 0.3241459201371808 [87] [92] 2 hSpCas9 negative selection 608218
23424911 23424934 16 + 26472758 K562 viability GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 0.44174988644941093 [729] [836] 3 hSpCas9 negative selection 608219
23424777 23424800 16 + 26472758 K562 viability GCCCTTGGCGAAGTGGGCGGTGG COG7 ENSG00000168434 0.5395467632100942 [162] [199] 4 hSpCas9 negative selection 608220
23418792 23418815 16 - 26472758 K562 viability GGTAAAAGTCACGGAGCTGGTGG COG7 ENSG00000168434 -0.19885245234134097 [343] [252] -1 hSpCas9 negative selection 608221
23406151 23406174 16 - 26472758 K562 viability AGAACTCTGCCAAGAACCCATGG COG7 ENSG00000168434 0.44723561066613376 [317] [365] 3 hSpCas9 negative selection 608222
23398061 23398084 16 + 26472758 K562 viability GAGAGGGGTGAGACTAAAGGCGG COG7 ENSG00000168434 -0.3887273065646745 [410] [264] -3 hSpCas9 negative selection 608223
23418741 23418764 16 + 26627737 DLD1 viability CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 1.0204808572106223 [543] [285,402,347] 8 hSpCas9 negative selection 793222
23424778 23424801 16 - 26627737 DLD1 viability GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.9619880351149268 [359] [228,236,195] 8 hSpCas9 negative selection 793223
23433554 23433577 16 - 26627737 DLD1 viability CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.13548687375692248 [733] [175,253,199] -1 hSpCas9 negative selection 793224
23434641 23434664 16 + 26627737 DLD1 viability GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 1.2667917590197257 [110] [48,153,54] 9 hSpCas9 negative selection 793225
23442496 23442519 16 + 26627737 DLD1 viability TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.8416940781663286 [812] [265,77,86] -7 hSpCas9 negative selection 793226
23418741 23418764 16 + 26627737 GBM cells viability after 5 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.15543497376080495 [369] [197,243] 2 hSpCas9 negative selection 875537
23424778 23424801 16 - 26627737 GBM cells viability after 5 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.1931992147039192 [273] [207,127] 3 hSpCas9 negative selection 875538
23433554 23433577 16 - 26627737 GBM cells viability after 5 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.13457378042363444 [522] [265,244] -2 hSpCas9 negative selection 875539
23434641 23434664 16 + 26627737 GBM cells viability after 5 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 -0.27942336637282716 [42] [14,22] -4 hSpCas9 negative selection 875540
23442496 23442519 16 + 26627737 GBM cells viability after 5 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.16675304276330893 [426] [205,201] -3 hSpCas9 negative selection 875541
23418741 23418764 16 + 26627737 GBM cells viability after 13 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.21645493391389392 [369] [251,217] 2 hSpCas9 negative selection 957852
23424778 23424801 16 - 26627737 GBM cells viability after 13 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.08644116845874747 [273] [196,125] 1 hSpCas9 negative selection 957853
23433554 23433577 16 - 26627737 GBM cells viability after 13 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 0.20503690871167213 [522] [475,205] 2 hSpCas9 negative selection 957854
23434641 23434664 16 + 26627737 GBM cells viability after 13 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.7980437927591038 [42] [71,14] 8 hSpCas9 negative selection 957855
23442496 23442519 16 + 26627737 GBM cells viability after 13 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.1270044386522673 [426] [327,191] 1 hSpCas9 negative selection 957856
23418741 23418764 16 + 26627737 GBM cells viability after 21 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.13101282731324493 [369] [228,211] 1 hSpCas9 negative selection 1040167
23424778 23424801 16 - 26627737 GBM cells viability after 21 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.02600990979115328 [273] [149,152] 0 hSpCas9 negative selection 1040168
23433554 23433577 16 - 26627737 GBM cells viability after 21 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.5499427102845401 [522] [203,184] -5 hSpCas9 negative selection 1040169
23434641 23434664 16 + 26627737 GBM cells viability after 21 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.3075206953016809 [42] [30,26] 3 hSpCas9 negative selection 1040170
23442496 23442519 16 + 26627737 GBM cells viability after 21 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.06879943405313715 [426] [235,249] 0 hSpCas9 negative selection 1040171
23418741 23418764 16 + 26627737 RPE1 viability after 9 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.6142910195660172 [976] [393,563] 4 hSpCas9 negative selection 1122482
23424778 23424801 16 - 26627737 RPE1 viability after 9 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.34308338856868137 [1453] [624,515] 2 hSpCas9 negative selection 1122483
23433554 23433577 16 - 26627737 RPE1 viability after 9 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 0.35972536472432665 [979] [332,471] 2 hSpCas9 negative selection 1122484
23434641 23434664 16 + 26627737 RPE1 viability after 9 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 -0.43032488486940224 [417] [59,144] -3 hSpCas9 negative selection 1122485
23442496 23442519 16 + 26627737 RPE1 viability after 9 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.3545116409490362 [633] [172,357] 2 hSpCas9 negative selection 1122486
23418741 23418764 16 + 26627737 RPE1 viability after 12 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.673029718557123 [976] [384,453] 4 hSpCas9 negative selection 1204797
23424778 23424801 16 - 26627737 RPE1 viability after 12 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.7133224398609966 [1453] [537,748] 4 hSpCas9 negative selection 1204798
23433554 23433577 16 - 26627737 RPE1 viability after 12 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 0.4995184601215041 [979] [345,399] 3 hSpCas9 negative selection 1204799
23434641 23434664 16 + 26627737 RPE1 viability after 12 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.3341386047211393 [417] [75,210] 2 hSpCas9 negative selection 1204800
23442496 23442519 16 + 26627737 RPE1 viability after 12 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.41141257495149 [633] [227,224] 2 hSpCas9 negative selection 1204801
23418741 23418764 16 + 26627737 RPE1 viability after 15 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.4975087256799717 [976] [295,480] 3 hSpCas9 negative selection 1287112
23424778 23424801 16 - 26627737 RPE1 viability after 15 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.652539802795797 [1453] [615,675] 4 hSpCas9 negative selection 1287113
23433554 23433577 16 - 26627737 RPE1 viability after 15 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 0.6428516277596745 [979] [440,424] 4 hSpCas9 negative selection 1287114
23434641 23434664 16 + 26627737 RPE1 viability after 15 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 1.2194805337325114 [417] [255,293] 7 hSpCas9 negative selection 1287115
23442496 23442519 16 + 26627737 RPE1 viability after 15 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.5636647982968523 [633] [288,241] 3 hSpCas9 negative selection 1287116
23418741 23418764 16 + 26627737 RPE1 viability after 18 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.19263376957725492 [976] [90,379] -1 hSpCas9 negative selection 1369427
23424778 23424801 16 - 26627737 RPE1 viability after 18 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.4375445770751364 [1453] [455,611] 2 hSpCas9 negative selection 1369428
23433554 23433577 16 - 26627737 RPE1 viability after 18 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 0.4847443743839998 [979] [357,382] 3 hSpCas9 negative selection 1369429
23434641 23434664 16 + 26627737 RPE1 viability after 18 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 1.1303164506489753 [417] [113,388] 6 hSpCas9 negative selection 1369430
23442496 23442519 16 + 26627737 RPE1 viability after 18 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.2662356922072134 [633] [169,243] 1 hSpCas9 negative selection 1369431
23418741 23418764 16 + 26627737 HeLa viability after 8 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.4904290377638082 [454] [313,200,323] 4 hSpCas9 negative selection 1451742
23424778 23424801 16 - 26627737 HeLa viability after 8 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 -0.6281027321443426 [659] [363,110,125] -6 hSpCas9 negative selection 1451743
23433554 23433577 16 - 26627737 HeLa viability after 8 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.06531923641825244 [866] [443,442,222] 0 hSpCas9 negative selection 1451744
23434641 23434664 16 + 26627737 HeLa viability after 8 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 -0.6020380840127224 [90] [89,0,2] -5 hSpCas9 negative selection 1451745
23442496 23442519 16 + 26627737 HeLa viability after 8 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.10187562646241483 [475] [176,303,178] 1 hSpCas9 negative selection 1451746
23418741 23418764 16 + 26627737 HeLa viability after 12 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.5095634620948132 [454] [278,195,335] 4 hSpCas9 negative selection 1534057
23424778 23424801 16 - 26627737 HeLa viability after 12 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.4377784218135322 [659] [648,222,259] 4 hSpCas9 negative selection 1534058
23433554 23433577 16 - 26627737 HeLa viability after 12 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.591216877334172 [866] [278,234,200] -5 hSpCas9 negative selection 1534059
23434641 23434664 16 + 26627737 HeLa viability after 12 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.7754566680407389 [90] [72,48,72] 6 hSpCas9 negative selection 1534060
23442496 23442519 16 + 26627737 HeLa viability after 12 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.20034633302051147 [475] [363,103,226] 1 hSpCas9 negative selection 1534061
23418741 23418764 16 + 26627737 HeLa viability after 15 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.8225569600890957 [454] [168,328,499] 6 hSpCas9 negative selection 1616372
23424778 23424801 16 - 26627737 HeLa viability after 15 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 -0.34647624504907 [659] [126,224,288] -3 hSpCas9 negative selection 1616373
23433554 23433577 16 - 26627737 HeLa viability after 15 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.6323070657388712 [866] [200,187,299] -5 hSpCas9 negative selection 1616374
23434641 23434664 16 + 26627737 HeLa viability after 15 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.35703584987590187 [90] [46,27,68] 3 hSpCas9 negative selection 1616375
23442496 23442519 16 + 26627737 HeLa viability after 15 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.027822301018458007 [475] [257,146,185] 0 hSpCas9 negative selection 1616376
23418741 23418764 16 + 26627737 HeLa viability after 18 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.8308426002609991 [454] [110,279,499] 6 hSpCas9 negative selection 1698687
23424778 23424801 16 - 26627737 HeLa viability after 18 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 -0.4025035528098423 [659] [76,176,288] -3 hSpCas9 negative selection 1698688
23433554 23433577 16 - 26627737 HeLa viability after 18 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.5912049109514409 [866] [148,153,299] -5 hSpCas9 negative selection 1698689
23434641 23434664 16 + 26627737 HeLa viability after 18 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.371295111145979 [90] [30,24,68] 3 hSpCas9 negative selection 1698690
23442496 23442519 16 + 26627737 HeLa viability after 18 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.034992242252218586 [475] [177,117,185] 0 hSpCas9 negative selection 1698691
23418741 23418764 16 + 26627737 HCT116 viability after 6 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.7732605275032245 [745] [358,112] 4 hSpCas9 negative selection 1781002
23424778 23424801 16 - 26627737 HCT116 viability after 6 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.6012664184272849 [935] [326,165] 3 hSpCas9 negative selection 1781003
23433554 23433577 16 - 26627737 HCT116 viability after 6 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.5610968826386861 [865] [177,44] -3 hSpCas9 negative selection 1781004
23434641 23434664 16 + 26627737 HCT116 viability after 6 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 -0.1600368208265116 [329] [126,1] -1 hSpCas9 negative selection 1781005
23442496 23442519 16 + 26627737 HCT116 viability after 6 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 1.1396155438796542 [1126] [147,523] 6 hSpCas9 negative selection 1781006
23418741 23418764 16 + 26627737 HCT116 viability after 8 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 1.5260477641892547 [206] [345,327,311] 9 hSpCas9 negative selection 1863317
23424778 23424801 16 - 26627737 HCT116 viability after 8 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.8063409677394758 [224] [320,171,159] 7 hSpCas9 negative selection 1863318
23433554 23433577 16 - 26627737 HCT116 viability after 8 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.2026406258094362 [789] [235,413,480] -2 hSpCas9 negative selection 1863319
23434641 23434664 16 + 26627737 HCT116 viability after 8 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 -0.09781455390027394 [79] [95,23,4] -1 hSpCas9 negative selection 1863320
23442496 23442519 16 + 26627737 HCT116 viability after 8 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.5612859903086153 [449] [179,127,195] -6 hSpCas9 negative selection 1863321
23418741 23418764 16 + 26627737 HCT116 viability after 9 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.21235603624008392 [745] [270,198] 1 hSpCas9 negative selection 1945632
23424778 23424801 16 - 26627737 HCT116 viability after 9 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.7107092316074164 [935] [422,397] 5 hSpCas9 negative selection 1945633
23433554 23433577 16 - 26627737 HCT116 viability after 9 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 0.1977917758017284 [865] [286,247] 1 hSpCas9 negative selection 1945634
23434641 23434664 16 + 26627737 HCT116 viability after 9 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 -0.22939773917461015 [329] [168,0] -1 hSpCas9 negative selection 1945635
23442496 23442519 16 + 26627737 HCT116 viability after 9 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.502177046073789 [1126] [331,117] -4 hSpCas9 negative selection 1945636
23418741 23418764 16 + 26627737 HCT116 viability after 12 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 1.1492552381803756 [206] [225,315,184] 8 hSpCas9 negative selection 2027947
23424778 23424801 16 - 26627737 HCT116 viability after 12 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.8079424995857314 [224] [251,244,120] 7 hSpCas9 negative selection 2027948
23433554 23433577 16 - 26627737 HCT116 viability after 12 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.7582168971388735 [789] [238,247,249] -7 hSpCas9 negative selection 2027949
23434641 23434664 16 + 26627737 HCT116 viability after 12 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.7397897855578253 [79] [87,108,12] 6 hSpCas9 negative selection 2027950
23442496 23442519 16 + 26627737 HCT116 viability after 12 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.14749371367399766 [449] [212,272,155] -1 hSpCas9 negative selection 2027951
23418741 23418764 16 + 26627737 HCT116 viability after 15 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 1.6936296552660521 [206] [447,466,247] 9 hSpCas9 negative selection 2110262
23424778 23424801 16 - 26627737 HCT116 viability after 15 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 0.46699111519141534 [224] [158,242,131] 4 hSpCas9 negative selection 2110263
23433554 23433577 16 - 26627737 HCT116 viability after 15 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.2576853998152857 [789] [481,295,372] -3 hSpCas9 negative selection 2110264
23434641 23434664 16 + 26627737 HCT116 viability after 15 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.7882850859904342 [79] [120,116,5] 7 hSpCas9 negative selection 2110265
23442496 23442519 16 + 26627737 HCT116 viability after 15 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.23541190349639396 [449] [558,186,198] 2 hSpCas9 negative selection 2110266
23418741 23418764 16 + 26627737 HCT116 viability after 18 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 1.3944106147543267 [206] [221,358,198] 8 hSpCas9 negative selection 2192577
23424778 23424801 16 - 26627737 HCT116 viability after 18 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 1.3051641751693688 [224] [313,227,266] 8 hSpCas9 negative selection 2192578
23433554 23433577 16 - 26627737 HCT116 viability after 18 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.09833776899398372 [789] [303,397,365] -1 hSpCas9 negative selection 2192579
23434641 23434664 16 + 26627737 HCT116 viability after 18 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.7625106109092157 [79] [54,59,82] 6 hSpCas9 negative selection 2192580
23442496 23442519 16 + 26627737 HCT116 viability after 18 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.3682308736384222 [449] [388,222,231] 3 hSpCas9 negative selection 2192581
23429027 23429050 16 + 25494202 A375 resistance to PLX-4720 (puromycin) TCGCCCAGACTGGAGTGCAGTAG COG7 ENSG00000168434 0.35999765204224765 [28,7] [7,0] 1 dCas9-VP64 positive selection 2386731
23438008 23438031 16 - 25494202 A375 resistance to PLX-4720 (puromycin) TCGCTGCAACCTCTGCCTCCCGG COG7 ENSG00000168434 -0.9365880081613079 [154,441] [7,61] -5 dCas9-VP64 positive selection 2389229
23419632 23419655 16 - 25494202 A375 resistance to PLX-4720 (puromycin) GCCTCAGCCTCCCGAGTAGCAGG COG7 ENSG00000168434 0.5805591546882161 [16,8] [5,1] 2 dCas9-VP64 positive selection 2421435
23425404 23425427 16 + 25494202 A375 resistance to PLX-4720 (puromycin) TCACTGCAGCCTTTAACTCCCAG COG7 ENSG00000168434 -1.7142589782577375 [182,184] [19,3] -8 dCas9-VP64 positive selection 2429855
23417712 23417735 16 + 25494202 A375 resistance to PLX-4720 (puromycin) TGTGCCACTGCACTCCAACCTGG COG7 ENSG00000168434 -0.3603328806955275 [13,219] [8,31] -2 dCas9-VP64 positive selection 2442226
23418474 23418497 16 + 25494202 A375 resistance to PLX-4720 (puromycin) ACTCCAGCCTGGGCGACAGATGG COG7 ENSG00000168434 1.2012671036636573 [14,1] [1,5] 5 dCas9-VP64 positive selection 2455017
23429027 23429050 16 + 25494202 A375 resistance to PLX-4720 (zeocin) TCGCCCAGACTGGAGTGCAGTAG COG7 ENSG00000168434 0.05401708914906567 [74,30] [24,10] 0 dCas9-VP64 positive selection 2481986
23438008 23438031 16 - 25494202 A375 resistance to PLX-4720 (zeocin) TCGCTGCAACCTCTGCCTCCCGG COG7 ENSG00000168434 -0.39148980799888866 [423,502] [155,76] -4 dCas9-VP64 positive selection 2484484
23419632 23419655 16 - 25494202 A375 resistance to PLX-4720 (zeocin) GCCTCAGCCTCCCGAGTAGCAGG COG7 ENSG00000168434 0.21208715000527545 [37,95] [24,24] 1 dCas9-VP64 positive selection 2516690
23425404 23425427 16 + 25494202 A375 resistance to PLX-4720 (zeocin) TCACTGCAGCCTTTAACTCCCAG COG7 ENSG00000168434 -1.495187672432472 [104,314] [26,20] -9 dCas9-VP64 positive selection 2525110
23417712 23417735 16 + 25494202 A375 resistance to PLX-4720 (zeocin) TGTGCCACTGCACTCCAACCTGG COG7 ENSG00000168434 2.8983611220710697 [175,93] [650,31] 9 dCas9-VP64 positive selection 2537481
23418474 23418497 16 + 25494202 A375 resistance to PLX-4720 (zeocin) ACTCCAGCCTGGGCGACAGATGG COG7 ENSG00000168434 0.32779538109836626 [14,14] [4,6] 2 dCas9-VP64 positive selection 2550272
23434635 23434658 16 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CTACTACTACAAGTGTCACAAGG COG7 ENSG00000168434 0.30550950906936014 [6,5] [6,6] 6 hSpCas9 positive selection 2980344
23445893 23445916 16 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity TGTTGAAGCCCTAAAACAGGAGG COG7 ENSG00000168434 -0.3861022070776523 [2,2] [2,0] -5 hSpCas9 positive selection 2980345
23434635 23434658 16 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CTACTACTACAAGTGTCACAAGG COG7 ENSG00000168434 0.2515313892048412 [6,6] [6,4] 4 hSpCas9 positive selection 3048202
23445893 23445916 16 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity TGTTGAAGCCCTAAAACAGGAGG COG7 ENSG00000168434 -0.40283037978155256 [2,2] [2,0] -6 hSpCas9 positive selection 3048203
23445065 23445088 - 24336571 A375 resistance to PLX after 7 days CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.018083129610434817 [10,11] [11,9] 0 hSpCas9 positive selection 3106617
23445896 23445919 - 24336571 A375 resistance to PLX after 7 days TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 0.09618086858238795 [2,2] [2,2] 3 hSpCas9 positive selection 3106618
23445929 23445952 + 24336571 A375 resistance to PLX after 7 days TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.021038827646665315 [5,5] [5,4] 0 hSpCas9 positive selection 3106619
23445065 23445088 - 24336571 A375 resistance to PLX after 14 days CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.1455132705268095 [6,9] [2,3] -1 hSpCas9 positive selection 3164410
23445896 23445919 - 24336571 A375 resistance to PLX after 14 days TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 0.11798867111336175 [4,2] [1,1] 1 hSpCas9 positive selection 3164411
23445929 23445952 + 24336571 A375 resistance to PLX after 14 days TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.03219238253135592 [3,4] [1,1] 0 hSpCas9 positive selection 3164412
23445065 23445088 - 24336571 A375 viability after 7 days CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.1857706706801969 [13] [10,11] -3 hSpCas9 negative selection 3222203
23445896 23445919 - 24336571 A375 viability after 7 days TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -1.0129285256437657 [6] [2,2] -9 hSpCas9 negative selection 3222204
23445929 23445952 + 24336571 A375 viability after 7 days TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.2969912063444212 [7] [5,5] -4 hSpCas9 negative selection 3222205
23445065 23445088 - 24336571 A375 viability after 14 days CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.595520336129722 [13] [6,9] -6 hSpCas9 negative selection 3279996
23445896 23445919 - 24336571 A375 viability after 14 days TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.6308371684648799 [6] [4,2] -6 hSpCas9 negative selection 3279997
23445929 23445952 + 24336571 A375 viability after 14 days TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.5665714527063926 [7] [3,4] -6 hSpCas9 negative selection 3279998
23445065 23445088 16 - 27383988 293T resistance to West Nile virus (flavivirus) CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 1.3292191299276208 [43,77] [0,0] 6 hSpCas9 positive selection 3343959
23434636 23434659 16 + 27383988 293T resistance to West Nile virus (flavivirus) CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.2478237074972973 [130,232] [0,0] -1 hSpCas9 positive selection 3343960
23445104 23445127 16 - 27383988 293T resistance to West Nile virus (flavivirus) ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 -0.4647111411929865 [231,189] [0,0] -3 hSpCas9 positive selection 3343961
23434695 23434718 16 - 27383988 293T resistance to West Nile virus (flavivirus) TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.274055249070477 [184,184] [0,0] -2 hSpCas9 positive selection 3363183
23445896 23445919 16 - 27383988 293T resistance to West Nile virus (flavivirus) TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 1.3031299010589596 [61,61] [0,0] 5 hSpCas9 positive selection 3363184
23445929 23445952 16 + 27383988 293T resistance to West Nile virus (flavivirus) TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.7705797851240493 [260,260] [0,0] -5 hSpCas9 positive selection 3363185
23434635 23434658 16 - 26780180 HT29 viability (Avana library 4 designs) CTACTACTACAAGTGTCACAAGG COG7 ENSG00000168434 -0.625727100991908 [] [] -8 hSpCas9 negative selection 3416795
23445893 23445916 16 - 26780180 HT29 viability (Avana library 4 designs) TGTTGAAGCCCTAAAACAGGAGG COG7 ENSG00000168434 3.5864056180552 [] [] 9 hSpCas9 negative selection 3416796
23445893 23445916 16 - 26780180 A375 viability (Avana lentiCRISPRv2) TGTTGAAGCCCTAAAACAGGAGG COG7 ENSG00000168434 -11.835714133843 [] [] -8 hSpCas9 negative selection 3494495
23434635 23434658 16 - 26780180 A375 viability (Avana lentiCRISPRv2) CTACTACTACAAGTGTCACAAGG COG7 ENSG00000168434 -3.95959014414103 [] [] -4 hSpCas9 negative selection 3494496
23434675 23434698 16 - 26780180 A375 viability (Avana lentiCRISPRv2) AGGTGTTTACTGAAATTGACCGG COG7 ENSG00000168434 -1.99611378809595 [] [] -2 hSpCas9 negative selection 3494497
23424911 23424934 16 + 26780180 A375 viability (Avana lentiCRISPRv2) GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 -3.54807484372971 [] [] -4 hSpCas9 negative selection 3494498
23445893 23445916 16 - 26780180 A375 viability (Avana lentiGuide) TGTTGAAGCCCTAAAACAGGAGG COG7 ENSG00000168434 16.6841847534214 [] [] 8 hSpCas9 negative selection 3603154
23434635 23434658 16 - 26780180 A375 viability (Avana lentiGuide) CTACTACTACAAGTGTCACAAGG COG7 ENSG00000168434 -2.30704168500678 [] [] -4 hSpCas9 negative selection 3603155
23434675 23434698 16 - 26780180 A375 viability (Avana lentiGuide) AGGTGTTTACTGAAATTGACCGG COG7 ENSG00000168434 -4.2616959436117 [] [] -7 hSpCas9 negative selection 3603156
23424911 23424934 16 + 26780180 A375 viability (Avana lentiGuide) GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 8.85032776627694 [] [] 6 hSpCas9 negative selection 3603157
23445893 23445916 16 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) TGTTGAAGCCCTAAAACAGGAGG COG7 ENSG00000168434 -0.6464805623906877 [4] [2,2] -7 hSpCas9 positive selection 3711813
23434635 23434658 16 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CTACTACTACAAGTGTCACAAGG COG7 ENSG00000168434 -0.19733433184608626 [6] [5,5] -3 hSpCas9 positive selection 3711814
23434675 23434698 16 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AGGTGTTTACTGAAATTGACCGG COG7 ENSG00000168434 -0.47450691256778327 [5] [4,2] -6 hSpCas9 positive selection 3711815
23424911 23424934 16 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 0.06360287154565894 [4] [5,3] 1 hSpCas9 positive selection 3711816
23445893 23445916 16 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) TGTTGAAGCCCTAAAACAGGAGG COG7 ENSG00000168434 0.025760111530477886 [4] [3,4] 0 hSpCas9 positive selection 3820420
23434635 23434658 16 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CTACTACTACAAGTGTCACAAGG COG7 ENSG00000168434 0.30696977327068153 [7] [7,7] 8 hSpCas9 positive selection 3820421
23434675 23434698 16 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AGGTGTTTACTGAAATTGACCGG COG7 ENSG00000168434 -0.0485192656639184 [5] [3,4] 0 hSpCas9 positive selection 3820422
23424911 23424934 16 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCAGCACCATTACCACCTCGTGG COG7 ENSG00000168434 -0.2181673030880434 [5] [3,3] -3 hSpCas9 positive selection 3820423
23445104 23445127 16 - 26780180 A375 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 1.13121810322259 [] [] 6 hSpCas9 negative selection 3928421
23445065 23445088 16 - 26780180 A375 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 1.47075753074163 [] [] 8 hSpCas9 negative selection 3928422
23434636 23434659 16 + 26780180 A375 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 1.02835918733437 [] [] 5 hSpCas9 negative selection 3928423
23434695 23434718 16 - 26780180 A375 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 1.57680745020303 [] [] 8 hSpCas9 negative selection 3928424
23445896 23445919 16 - 26780180 A375 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 1.7174589609493 [] [] 9 hSpCas9 negative selection 3928425
23445929 23445952 16 + 26780180 A375 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 1.31111532648966 [] [] 7 hSpCas9 negative selection 3928426
23445104 23445127 16 - 26780180 HT29 viability (GeCKOv2 library) ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.798341591174705 [] [] 3 hSpCas9 negative selection 4036387
23445065 23445088 16 - 26780180 HT29 viability (GeCKOv2 library) CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 1.03442957155861 [] [] 5 hSpCas9 negative selection 4036388
23434636 23434659 16 + 26780180 HT29 viability (GeCKOv2 library) CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 1.26467341630293 [] [] 6 hSpCas9 negative selection 4036389
23434695 23434718 16 - 26780180 HT29 viability (GeCKOv2 library) TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.677992814347448 [] [] 2 hSpCas9 negative selection 4036390
23445896 23445919 16 - 26780180 HT29 viability (GeCKOv2 library) TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 2.07193821689024 [] [] 9 hSpCas9 negative selection 4036391
23445929 23445952 16 + 26780180 HT29 viability (GeCKOv2 library) TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.943611377128511 [] [] 4 hSpCas9 negative selection 4036392
23445065 23445088 16 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.06663533709448724 [3] [2,1] -1 hSpCas9 positive selection 4128807
23445896 23445919 16 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -1.0890351168720396 [2] [0,0] -9 hSpCas9 positive selection 4128808
23445929 23445952 16 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.9293787079922843 [2] [7,0] 9 hSpCas9 positive selection 4128809
23445065 23445088 16 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 1.5455357901181621 [1] [0,3,0,4] 9 hSpCas9 positive selection 4192829
23445896 23445919 16 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.6195225356089396 [2] [0,0,0,0] -8 hSpCas9 positive selection 4192830
23445929 23445952 16 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.08568004173845367 [2] [0,3,0,0] -1 hSpCas9 positive selection 4192831
23445065 23445088 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.1448911452423272 [2] [2,0] -3 hSpCas9 positive selection 4264184
23434636 23434659 16 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.2199779950288497 [3] [3,3] 4 hSpCas9 positive selection 4264185
23445104 23445127 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.08726037580191193 [3] [3,2] 1 hSpCas9 positive selection 4264186
23434695 23434718 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.5891981849797038 [2] [1,0] -8 hSpCas9 positive selection 4328455
23445896 23445919 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -1.2085465536751328 [2] [0,0] -9 hSpCas9 positive selection 4328456
23445929 23445952 16 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.22232170226956244 [3] [3,1] -4 hSpCas9 positive selection 4328457
23424738 23424760 16 + 27760321 OCIAML3 viability GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -0.008196572061685337 [318,269] [166,307] 0 hSpCas9 negative selection 4390741
23424772 23424794 16 + 27760321 OCIAML3 viability TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -1.1313273257455791 [487,324] [114,179] -7 hSpCas9 negative selection 4390742
23433599 23433621 16 + 27760321 OCIAML3 viability TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.0611846915105172 [795,697] [599,618] 0 hSpCas9 negative selection 4390743
23442497 23442519 16 + 27760321 OCIAML3 viability GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.37280762401331713 [789,610] [393,453] -4 hSpCas9 negative selection 4390744
23418742 23418764 16 + 27760321 OCIAML3 viability CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.25020148426343514 [651,595] [397,425] -3 hSpCas9 negative selection 4390745
23424738 23424760 16 + 27760321 OCIAML2 viability GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -1.0568387052101342 [318,269] [76,162] -7 hSpCas9 negative selection 4474204
23424772 23424794 16 + 27760321 OCIAML2 viability TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.6746378908714366 [487,324] [179,233] -6 hSpCas9 negative selection 4474205
23433599 23433621 16 + 27760321 OCIAML2 viability TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 -0.1684465683454247 [795,697] [473,618] -2 hSpCas9 negative selection 4474206
23442497 23442519 16 + 27760321 OCIAML2 viability GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.08417645612411473 [789,610] [579,617] 1 hSpCas9 negative selection 4474207
23418742 23418764 16 + 27760321 OCIAML2 viability CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.8419482873612507 [651,595] [290,268] -7 hSpCas9 negative selection 4474208
23424738 23424760 16 + 27760321 MV411 viability GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 0.11652481402944215 [318,269] [139,314] 0 hSpCas9 negative selection 4557667
23424772 23424794 16 + 27760321 MV411 viability TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.04002566717287359 [487,324] [344,125] 0 hSpCas9 negative selection 4557668
23433599 23433621 16 + 27760321 MV411 viability TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.5576762523282683 [795,697] [532,1010] 4 hSpCas9 negative selection 4557669
23442497 23442519 16 + 27760321 MV411 viability GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.7655172402255463 [789,610] [746,829] 5 hSpCas9 negative selection 4557670
23418742 23418764 16 + 27760321 MV411 viability CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.6062243362528342 [651,595] [263,279] -4 hSpCas9 negative selection 4557671
23424738 23424760 16 + 27760321 HL60 viability GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -0.23255959764353806 [318,269] [204,202] -3 hSpCas9 negative selection 4641130
23424772 23424794 16 + 27760321 HL60 viability TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.1499026182667928 [487,324] [339,247] -2 hSpCas9 negative selection 4641131
23433599 23433621 16 + 27760321 HL60 viability TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.1445017249628463 [795,697] [658,687] 1 hSpCas9 negative selection 4641132
23442497 23442519 16 + 27760321 HL60 viability GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.3279147644121475 [789,610] [372,536] -4 hSpCas9 negative selection 4641133
23418742 23418764 16 + 27760321 HL60 viability CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.5292195742119562 [651,595] [288,420] -5 hSpCas9 negative selection 4641134
23424738 23424760 16 + 27760321 HT1080 viability GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -2.73762060603676 [269,210] [0,28] -7 hSpCas9 negative selection 4724593
23424772 23424794 16 + 27760321 HT1080 viability TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.35463642483344293 [324,253] [104,73] -2 hSpCas9 negative selection 4724594
23433599 23433621 16 + 27760321 HT1080 viability TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 -3.980709354422596 [697,544] [8,22] -8 hSpCas9 negative selection 4724595
23442497 23442519 16 + 27760321 HT1080 viability GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -5.247739716432977 [610,476] [9,0] -8 hSpCas9 negative selection 4724596
23418742 23418764 16 + 27760321 HT1080 viability CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -1.9673577438223802 [595,464] [75,29] -6 hSpCas9 negative selection 4724597
23424738 23424760 16 + 27760321 HT29 viability after 7 days GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -0.6188597326196781 [269,210] [308,166,144] -7 hSpCas9 negative selection 4808056
23424772 23424794 16 + 27760321 HT29 viability after 7 days TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 0.3057346930789466 [324,253] [516,353,514] 5 hSpCas9 negative selection 4808057
23433599 23433621 16 + 27760321 HT29 viability after 7 days TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.6502744358225785 [697,544] [980,1464,1274] 8 hSpCas9 negative selection 4808058
23442497 23442519 16 + 27760321 HT29 viability after 7 days GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.08455050085701843 [610,476] [750,788,686] 1 hSpCas9 negative selection 4808059
23418742 23418764 16 + 27760321 HT29 viability after 7 days CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.8325212841647469 [595,464] [460,296,400] -8 hSpCas9 negative selection 4808060
23424738 23424760 16 + 27760321 HT29 viability after 25 days GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -0.7602307938258601 [269,210] [158,94,240] -6 hSpCas9 negative selection 4891519
23424772 23424794 16 + 27760321 HT29 viability after 25 days TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.19486599426321383 [324,253] [229,303,341] -2 hSpCas9 negative selection 4891520
23433599 23433621 16 + 27760321 HT29 viability after 25 days TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.31400957284992415 [697,544] [850,817,991] 3 hSpCas9 negative selection 4891521
23442497 23442519 16 + 27760321 HT29 viability after 25 days GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.7879819565561871 [610,476] [953,1261,1002] 8 hSpCas9 negative selection 4891522
23418742 23418764 16 + 27760321 HT29 viability after 25 days CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -1.0941275056532067 [595,464] [250,159,460] -7 hSpCas9 negative selection 4891523
23424738 23424760 16 + 27760321 HT29 viability after 22 days GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -0.8488857970951083 [269,210] [188,138,133] -6 hSpCas9 negative selection 4974982
23424772 23424794 16 + 27760321 HT29 viability after 22 days TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.24061524273448587 [324,253] [334,277,234] -3 hSpCas9 negative selection 4974983
23433599 23433621 16 + 27760321 HT29 viability after 22 days TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.27230025292424287 [697,544] [968,816,813] 3 hSpCas9 negative selection 4974984
23442497 23442519 16 + 27760321 HT29 viability after 22 days GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.8951411462644044 [610,476] [1137,1273,1096] 9 hSpCas9 negative selection 4974985
23418742 23418764 16 + 27760321 HT29 viability after 22 days CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.6725557379679787 [595,464] [324,329,501] -5 hSpCas9 negative selection 4974986
23424738 23424760 16 + 27760321 HT29 viability after 19 days GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -0.2919150714911337 [269,210] [282,171,224] -3 hSpCas9 negative selection 5058445
23424772 23424794 16 + 27760321 HT29 viability after 19 days TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.7600539226560529 [324,253] [231,182,175] -6 hSpCas9 negative selection 5058446
23433599 23433621 16 + 27760321 HT29 viability after 19 days TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.14291652336830385 [697,544] [668,1186,496] 1 hSpCas9 negative selection 5058447
23442497 23442519 16 + 27760321 HT29 viability after 19 days GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.7357444523879683 [610,476] [1317,942,881] 7 hSpCas9 negative selection 5058448
23418742 23418764 16 + 27760321 HT29 viability after 19 days CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.5248753366336794 [595,464] [317,302,624] -4 hSpCas9 negative selection 5058449
23424738 23424760 16 + 27760321 HT29 viability after 16 days GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 0.11261651891333829 [269,210] [146,450,256] 1 hSpCas9 negative selection 5141908
23424772 23424794 16 + 27760321 HT29 viability after 16 days TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 0.41405799444232405 [324,253] [327,467,487] 5 hSpCas9 negative selection 5141909
23433599 23433621 16 + 27760321 HT29 viability after 16 days TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.5080850086263218 [697,544] [812,871,1267] 6 hSpCas9 negative selection 5141910
23442497 23442519 16 + 27760321 HT29 viability after 16 days GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.6247186126698866 [610,476] [981,1258,569] 7 hSpCas9 negative selection 5141911
23418742 23418764 16 + 27760321 HT29 viability after 16 days CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 0.10936181992998895 [595,464] [1001,403,554] 1 hSpCas9 negative selection 5141912
23424738 23424760 16 + 27760321 HT29 viability after 13 days GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 0.2378151433186545 [269,210] [446,248,292] 3 hSpCas9 negative selection 5225371
23424772 23424794 16 + 27760321 HT29 viability after 13 days TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 0.10494265852116863 [324,253] [252,403,422] 1 hSpCas9 negative selection 5225372
23433599 23433621 16 + 27760321 HT29 viability after 13 days TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.6458606741397084 [697,544] [1260,909,1207] 8 hSpCas9 negative selection 5225373
23442497 23442519 16 + 27760321 HT29 viability after 13 days GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.6853243452597869 [610,476] [1314,1093,656] 8 hSpCas9 negative selection 5225374
23418742 23418764 16 + 27760321 HT29 viability after 13 days CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.23863271246180034 [595,464] [579,316,658] -3 hSpCas9 negative selection 5225375
23424738 23424760 16 + 27760321 HT29 viability after 10 days GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 -0.0832846030178851 [269,210] [207,430,216] -1 hSpCas9 negative selection 5308834
23424772 23424794 16 + 27760321 HT29 viability after 10 days TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 0.42969559067504787 [324,253] [582,350,521] 6 hSpCas9 negative selection 5308835
23433599 23433621 16 + 27760321 HT29 viability after 10 days TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 0.61669607753846 [697,544] [936,1333,1299] 8 hSpCas9 negative selection 5308836
23442497 23442519 16 + 27760321 HT29 viability after 10 days GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 0.9295788730549549 [610,476] [1530,1307,1047] 9 hSpCas9 negative selection 5308837
23418742 23418764 16 + 27760321 HT29 viability after 10 days CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.3125807233616981 [595,464] [686,406,502] -4 hSpCas9 negative selection 5308838
23424738 23424760 16 + 27760321 MOLM13 viability GGAATGTTTACGTAGGTGGGGG COG7 ENSG00000168434 1.0001573234530203 [318,269] [32,584] 7 hSpCas9 negative selection 5392297
23424772 23424794 16 + 27760321 MOLM13 viability TCCAAGCCCTTGGCGAAGTGGG COG7 ENSG00000168434 -0.7676589107720819 [487,324] [79,177] -5 hSpCas9 negative selection 5392298
23433599 23433621 16 + 27760321 MOLM13 viability TCCGGTAAGCTGCCGGTCCAGG COG7 ENSG00000168434 -0.9116496931003321 [795,697] [410,63] -5 hSpCas9 negative selection 5392299
23442497 23442519 16 + 27760321 MOLM13 viability GCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.3509168056347876 [789,610] [466,171] -2 hSpCas9 negative selection 5392300
23418742 23418764 16 + 27760321 MOLM13 viability CATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -1.8972773721429461 [651,595] [188,13] -8 hSpCas9 negative selection 5392301
23452733 23452756 16 - 27661255 K562 viability GTGAGGCACTCAGGTGGGCGGGG COG7 ENSG00000168434 -0.1650167804376147 [1248,1215] [911,849] -5 dCas9-KRAB negative selection 5471977
23445065 23445088 16 - 27260156 BXPC3 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.013833894853399809 [277] [241,317,247,351] 0 hSpCas9 negative selection 5536644
23434636 23434659 16 + 27260156 BXPC3 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.2606282180045211 [676] [863,775,896,852] 6 hSpCas9 negative selection 5536645
23445104 23445127 16 - 27260156 BXPC3 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.4589076140686301 [639] [820,887,825,1180] 8 hSpCas9 negative selection 5536646
23434695 23434718 16 - 27260156 BXPC3 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.13492938572124752 [437] [463,490,454,615] 3 hSpCas9 negative selection 5600915
23445896 23445919 16 - 27260156 BXPC3 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.11473462774161192 [235] [315,139,199,251] -3 hSpCas9 negative selection 5600916
23445929 23445952 16 + 27260156 BXPC3 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.13730874591690617 [606] [650,647,726,779] 3 hSpCas9 negative selection 5600917
23445065 23445088 16 - 27260156 A673 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.2592513339143765 [277] [286,299,215,314] -6 hSpCas9 negative selection 5657895
23434636 23434659 16 + 27260156 A673 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.16948778413359267 [676] [830,688,611,774] -4 hSpCas9 negative selection 5657896
23445104 23445127 16 - 27260156 A673 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.31367350639757474 [639] [993,790,1028,1015] 7 hSpCas9 negative selection 5657897
23434695 23434718 16 - 27260156 A673 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.09836794107046339 [437] [623,650,506,468] 2 hSpCas9 negative selection 5722166
23445896 23445919 16 - 27260156 A673 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.911037533040743 [235] [191,156,143,111] -9 hSpCas9 negative selection 5722167
23445929 23445952 16 + 27260156 A673 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.08716423637724457 [606] [780,599,648,728] -2 hSpCas9 negative selection 5722168
23445065 23445088 16 - 27260156 A375 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.31764228997415156 [277] [200,293,258,287] -4 hSpCas9 negative selection 5779146
23434636 23434659 16 + 27260156 A375 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.0212797888039028 [676] [740,776,911,775] 0 hSpCas9 negative selection 5779147
23445104 23445127 16 - 27260156 A375 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.5677751151058783 [639] [1022,1319,1194,938] 8 hSpCas9 negative selection 5779148
23434695 23434718 16 - 27260156 A375 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.038275207452357116 [437] [538,570,592,415] 0 hSpCas9 negative selection 5843417
23445896 23445919 16 - 27260156 A375 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.605413920766191 [235] [126,236,228,142] -7 hSpCas9 negative selection 5843418
23445929 23445952 16 + 27260156 A375 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.39991282801003275 [606] [653,720,384,426] -5 hSpCas9 negative selection 5843419
23445065 23445088 16 - 27260156 COLO741 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 0.1059635232067484 [277] [463,379,313] 2 hSpCas9 negative selection 5900397
23434636 23434659 16 + 27260156 COLO741 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.01711722279803163 [676] [777,990,791] 0 hSpCas9 negative selection 5900398
23445104 23445127 16 - 27260156 COLO741 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.46489461681808364 [639] [1325,1324,775] 8 hSpCas9 negative selection 5900399
23434695 23434718 16 - 27260156 COLO741 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.052856145397828326 [437] [587,601,552] 1 hSpCas9 negative selection 5964668
23445896 23445919 16 - 27260156 COLO741 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.00031055068665442054 [235] [271,434,201] 0 hSpCas9 negative selection 5964669
23445929 23445952 16 + 27260156 COLO741 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.1933042997349686 [606] [824,854,966] 4 hSpCas9 negative selection 5964670
23445065 23445088 16 - 27260156 CAL120 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.5103408938862501 [277] [261,204,263] -6 hSpCas9 negative selection 6021648
23434636 23434659 16 + 27260156 CAL120 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.03418414467409342 [676] [853,765,851] 0 hSpCas9 negative selection 6021649
23445104 23445127 16 - 27260156 CAL120 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.7128760396571898 [639] [1488,1361,1095] 9 hSpCas9 negative selection 6021650
23434695 23434718 16 - 27260156 CAL120 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.17800145556902108 [437] [565,476,415] -3 hSpCas9 negative selection 6085919
23445896 23445919 16 - 27260156 CAL120 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.7844530936128562 [235] [151,205,150] -8 hSpCas9 negative selection 6085920
23445929 23445952 16 + 27260156 CAL120 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.49886635863016465 [606] [859,406,387] -6 hSpCas9 negative selection 6085921
23445065 23445088 16 - 27260156 CADOES1 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.6304093535602013 [277] [132,252,124,156] -8 hSpCas9 negative selection 6142899
23434636 23434659 16 + 27260156 CADOES1 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.16599818266308575 [676] [579,689,543,425] -3 hSpCas9 negative selection 6142900
23445104 23445127 16 - 27260156 CADOES1 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.6027856200117296 [639] [968,927,985,725] 8 hSpCas9 negative selection 6142901
23434695 23434718 16 - 27260156 CADOES1 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.08784586390762739 [437] [411,317,291,515] -1 hSpCas9 negative selection 6207170
23445896 23445919 16 - 27260156 CADOES1 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.8382659096714662 [235] [100,93,199,94] -9 hSpCas9 negative selection 6207171
23445929 23445952 16 + 27260156 CADOES1 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.3526872448313399 [606] [500,312,460,494] -6 hSpCas9 negative selection 6207172
23445065 23445088 16 - 27260156 EWS502 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.16253214020604612 [277] [223,268,240,325] -3 hSpCas9 negative selection 6264150
23434636 23434659 16 + 27260156 EWS502 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.29203288281246326 [676] [434,678,540,707] -5 hSpCas9 negative selection 6264151
23445104 23445127 16 - 27260156 EWS502 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.47181103318803663 [639] [909,1143,924,759] 7 hSpCas9 negative selection 6264152
23434695 23434718 16 - 27260156 EWS502 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.08779991014737781 [437] [288,534,404,535] -1 hSpCas9 negative selection 6328421
23445896 23445919 16 - 27260156 EWS502 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.42361725238810943 [235] [171,209,166,196] -6 hSpCas9 negative selection 6328422
23445929 23445952 16 + 27260156 EWS502 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.2380255138731504 [606] [496,516,539,637] -4 hSpCas9 negative selection 6328423
23445065 23445088 16 - 27260156 EW8 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.3731653898689202 [277] [261,253,82,121] -6 hSpCas9 negative selection 6385401
23434636 23434659 16 + 27260156 EW8 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.041407777322214345 [676] [695,569,418,610] 0 hSpCas9 negative selection 6385402
23445104 23445127 16 - 27260156 EW8 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.32860092701904375 [639] [936,488,533,693] 6 hSpCas9 negative selection 6385403
23434695 23434718 16 - 27260156 EW8 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.2331892617353326 [437] [475,431,359,415] 4 hSpCas9 negative selection 6449672
23445896 23445919 16 - 27260156 EW8 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.7086227547753765 [235] [118,93,73,187] -8 hSpCas9 negative selection 6449673
23445929 23445952 16 + 27260156 EW8 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.17230646803497968 [606] [488,614,468,649] 3 hSpCas9 negative selection 6449674
23445065 23445088 16 - 27260156 CORL105 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.24892932693034298 [277] [249,266,413,185] -4 hSpCas9 negative selection 6506652
23434636 23434659 16 + 27260156 CORL105 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.07882131701473588 [676] [591,805,728,863] -1 hSpCas9 negative selection 6506653
23445104 23445127 16 - 27260156 CORL105 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.5145825490559583 [639] [1185,1040,1145,924] 8 hSpCas9 negative selection 6506654
23434695 23434718 16 - 27260156 CORL105 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.044730332211562696 [437] [393,430,613,564] -1 hSpCas9 negative selection 6570923
23445896 23445919 16 - 27260156 CORL105 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.29274060100120525 [235] [245,234,270,157] -5 hSpCas9 negative selection 6570924
23445929 23445952 16 + 27260156 CORL105 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.1721820171452349 [606] [779,834,849,743] 3 hSpCas9 negative selection 6570925
23445065 23445088 16 - 27260156 HS294T viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.5721470845124303 [277] [82,43,68,96] -7 hSpCas9 negative selection 6627903
23434636 23434659 16 + 27260156 HS294T viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.0226406423505936 [676] [218,340,216,252] 0 hSpCas9 negative selection 6627904
23445104 23445127 16 - 27260156 HS294T viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.19805275554979418 [639] [254,274,266,351] 2 hSpCas9 negative selection 6627905
23434695 23434718 16 - 27260156 HS294T viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.13095794730115223 [437] [164,235,161,176] 1 hSpCas9 negative selection 6692174
23445896 23445919 16 - 27260156 HS294T viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.2597351798012566 [235] [116,44,71,65] -4 hSpCas9 negative selection 6692175
23445929 23445952 16 + 27260156 HS294T viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.07162670206846689 [606] [162,142,242,377] -1 hSpCas9 negative selection 6692176
23445065 23445088 16 - 27260156 HCC44 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.10582325550666771 [277] [251,195,373,365] -2 hSpCas9 negative selection 6749154
23434636 23434659 16 + 27260156 HCC44 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.2908012609752785 [676] [824,717,1378,914] 5 hSpCas9 negative selection 6749155
23445104 23445127 16 - 27260156 HCC44 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.48095881543005237 [639] [930,742,1453,1011] 7 hSpCas9 negative selection 6749156
23434695 23434718 16 - 27260156 HCC44 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.6147713762932694 [437] [821,399,889,987] 8 hSpCas9 negative selection 6813425
23445896 23445919 16 - 27260156 HCC44 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 0.16237758482354747 [235] [424,199,312,282] 2 hSpCas9 negative selection 6813426
23445929 23445952 16 + 27260156 HCC44 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.17694282436029068 [606] [894,690,933,632] 3 hSpCas9 negative selection 6813427
23445065 23445088 16 - 27260156 G402 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.5185771757419118 [277] [341,222,229,168] -6 hSpCas9 negative selection 6870405
23434636 23434659 16 + 27260156 G402 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.09899594207550877 [676] [1279,1046,515,764] 1 hSpCas9 negative selection 6870406
23445104 23445127 16 - 27260156 G402 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.20483159820443475 [639] [1190,820,866,761] 2 hSpCas9 negative selection 6870407
23434695 23434718 16 - 27260156 G402 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.7995457782089834 [437] [974,836,713,1179] 8 hSpCas9 negative selection 6934676
23445896 23445919 16 - 27260156 G402 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.806645467659201 [235] [166,135,197,155] -7 hSpCas9 negative selection 6934677
23445929 23445952 16 + 27260156 G402 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.30742742970920545 [606] [588,446,480,851] -4 hSpCas9 negative selection 6934678
23445065 23445088 16 - 27260156 L33 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.09176862992975077 [277] [251,100,207,214] -2 hSpCas9 negative selection 6991656
23434636 23434659 16 + 27260156 L33 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.22443373871042116 [676] [689,327,512,858] 5 hSpCas9 negative selection 6991657
23445104 23445127 16 - 27260156 L33 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.27996943939912833 [639] [821,316,500,714] 6 hSpCas9 negative selection 6991658
23434695 23434718 16 - 27260156 L33 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.3142840449534651 [437] [477,197,340,674] 6 hSpCas9 negative selection 7055927
23445896 23445919 16 - 27260156 L33 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.09699221875863495 [235] [227,78,142,233] -2 hSpCas9 negative selection 7055928
23445929 23445952 16 + 27260156 L33 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.06781600808503202 [606] [494,270,470,642] 1 hSpCas9 negative selection 7055929
23445065 23445088 16 - 27260156 K562 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 0.05420004641683751 [277] [351,125,426,133] 0 hSpCas9 negative selection 7112907
23434636 23434659 16 + 27260156 K562 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.6292677443615617 [676] [873,460,692,1578] 7 hSpCas9 negative selection 7112908
23445104 23445127 16 - 27260156 K562 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.6938468142671346 [639] [963,948,681,1063] 8 hSpCas9 negative selection 7112909
23434695 23434718 16 - 27260156 K562 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.9418491719957771 [437] [563,1166,723,557] 9 hSpCas9 negative selection 7177178
23445896 23445919 16 - 27260156 K562 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.24467938942797152 [235] [192,283,141,102] -3 hSpCas9 negative selection 7177179
23445929 23445952 16 + 27260156 K562 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.01843821619416719 [606] [557,698,573,377] 0 hSpCas9 negative selection 7177180
23445065 23445088 16 - 27260156 HT29 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.3208949539550454 [277] [283,257,310,231] -6 hSpCas9 negative selection 7234158
23434636 23434659 16 + 27260156 HT29 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.16116514829223605 [676] [940,827,853,1030] 3 hSpCas9 negative selection 7234159
23445104 23445127 16 - 27260156 HT29 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.3127509009806253 [639] [1156,948,965,817] 6 hSpCas9 negative selection 7234160
23434695 23434718 16 - 27260156 HT29 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.3840653154519374 [437] [649,808,674,651] 7 hSpCas9 negative selection 7298429
23445896 23445919 16 - 27260156 HT29 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.4412427873155611 [235] [284,170,215,177] -7 hSpCas9 negative selection 7298430
23445929 23445952 16 + 27260156 HT29 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.19150164254296215 [606] [1078,907,772,651] 4 hSpCas9 negative selection 7298431
23445065 23445088 16 - 27260156 MHHES1 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.3435554618085912 [277] [160,171,347,275] -6 hSpCas9 negative selection 7355409
23434636 23434659 16 + 27260156 MHHES1 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.04201342009435505 [676] [794,866,867,636] 0 hSpCas9 negative selection 7355410
23445104 23445127 16 - 27260156 MHHES1 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.332762302952881 [639] [1131,1137,749,690] 6 hSpCas9 negative selection 7355411
23434695 23434718 16 - 27260156 MHHES1 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.1778445572928653 [437] [665,715,546,364] 3 hSpCas9 negative selection 7419680
23445896 23445919 16 - 27260156 MHHES1 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.3076724035799068 [235] [416,238,167,86] -5 hSpCas9 negative selection 7419681
23445929 23445952 16 + 27260156 MHHES1 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.26034163175729597 [606] [799,386,568,531] -5 hSpCas9 negative selection 7419682
23445065 23445088 16 - 27260156 MEWO viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.3568138292149736 [277] [319,181,129] -6 hSpCas9 negative selection 7476660
23434636 23434659 16 + 27260156 MEWO viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.21983912098372682 [676] [740,815,655] 5 hSpCas9 negative selection 7476661
23445104 23445127 16 - 27260156 MEWO viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.2834131933352636 [639] [988,617,629] 6 hSpCas9 negative selection 7476662
23434695 23434718 16 - 27260156 MEWO viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.18599271784961682 [437] [555,421,437] 4 hSpCas9 negative selection 7540931
23445896 23445919 16 - 27260156 MEWO viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.6209095830796072 [235] [165,149,118] -8 hSpCas9 negative selection 7540932
23445929 23445952 16 + 27260156 MEWO viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.22596440691443706 [606] [569,468,433] -5 hSpCas9 negative selection 7540933
23445065 23445088 16 - 27260156 LNCAPCLONEFGC viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.8238392347999606 [277] [117,153,157,140] -8 hSpCas9 negative selection 7597911
23434636 23434659 16 + 27260156 LNCAPCLONEFGC viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.19579619802116854 [676] [512,535,509,578] -3 hSpCas9 negative selection 7597912
23445104 23445127 16 - 27260156 LNCAPCLONEFGC viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.7723019009394427 [639] [943,989,1218,841] 9 hSpCas9 negative selection 7597913
23434695 23434718 16 - 27260156 LNCAPCLONEFGC viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.28073188327474563 [437] [426,619,504,370] 4 hSpCas9 negative selection 7662182
23445896 23445919 16 - 27260156 LNCAPCLONEFGC viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.33328827801906025 [235] [135,128,270,160] -5 hSpCas9 negative selection 7662183
23445929 23445952 16 + 27260156 LNCAPCLONEFGC viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.06713831073175647 [606] [421,545,590,751] 1 hSpCas9 negative selection 7662184
23445065 23445088 16 - 27260156 PANC0327 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 0.492807509408248 [277] [843,188,235,181] 7 hSpCas9 negative selection 7719162
23434636 23434659 16 + 27260156 PANC0327 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.20770417297890964 [676] [713,532,425,423] -3 hSpCas9 negative selection 7719163
23445104 23445127 16 - 27260156 PANC0327 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.6409383037311749 [639] [759,1154,938,646] 8 hSpCas9 negative selection 7719164
23434695 23434718 16 - 27260156 PANC0327 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.6758624337310855 [437] [764,608,380,743] 8 hSpCas9 negative selection 7783433
23445896 23445919 16 - 27260156 PANC0327 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 0.18991356614178667 [235] [60,281,130,461] 3 hSpCas9 negative selection 7783434
23445929 23445952 16 + 27260156 PANC0327 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.18994133517462558 [606] [651,493,734,597] 3 hSpCas9 negative selection 7783435
23445065 23445088 16 - 27260156 NCIH2009 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -1.1855942040873917 [277] [225,165,130] -8 hSpCas9 negative selection 7840413
23434636 23434659 16 + 27260156 NCIH2009 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.6818665437691205 [676] [828,543,442] -7 hSpCas9 negative selection 7840414
23445104 23445127 16 - 27260156 NCIH2009 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.4663495369987737 [639] [1347,1035,1345] 6 hSpCas9 negative selection 7840415
23434695 23434718 16 - 27260156 NCIH2009 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.9137599380007375 [437] [491,267,247] -8 hSpCas9 negative selection 7904684
23445896 23445919 16 - 27260156 NCIH2009 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -1.5817310479997007 [235] [93,114,117] -9 hSpCas9 negative selection 7904685
23445929 23445952 16 + 27260156 NCIH2009 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.9555837466239305 [606] [629,394,324] -8 hSpCas9 negative selection 7904686
23445065 23445088 16 - 27260156 NCIH1373 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.381780590516664 [277] [420,206,58,80] -4 hSpCas9 negative selection 7961664
23434636 23434659 16 + 27260156 NCIH1373 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.10869354106766044 [676] [533,1054,706,113] -1 hSpCas9 negative selection 7961665
23445104 23445127 16 - 27260156 NCIH1373 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.7457911065947682 [639] [1132,878,1399,374] 7 hSpCas9 negative selection 7961666
23434695 23434718 16 - 27260156 NCIH1373 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.0049418846943598965 [437] [522,400,418,170] 0 hSpCas9 negative selection 8025935
23445896 23445919 16 - 27260156 NCIH1373 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.2616955033622763 [235] [142,332,213,42] -3 hSpCas9 negative selection 8025936
23445929 23445952 16 + 27260156 NCIH1373 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.4139703000505659 [606] [809,265,414,165] -4 hSpCas9 negative selection 8025937
23445065 23445088 16 - 27260156 PATU8902 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.007649582311400449 [277] [166,238,707,335] 0 hSpCas9 negative selection 8082915
23434636 23434659 16 + 27260156 PATU8902 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.2118939014314714 [676] [778,882,922,612] -2 hSpCas9 negative selection 8082916
23445104 23445127 16 - 27260156 PATU8902 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.5157064290897916 [639] [1635,1349,1060,1065] 5 hSpCas9 negative selection 8082917
23434695 23434718 16 - 27260156 PATU8902 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.16092614175151423 [437] [407,968,651,708] 1 hSpCas9 negative selection 8147186
23445896 23445919 16 - 27260156 PATU8902 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -1.7948589210911732 [235] [158,23,93,100] -8 hSpCas9 negative selection 8147187
23445929 23445952 16 + 27260156 PATU8902 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.1126857044826517 [606] [752,483,1087,706] -1 hSpCas9 negative selection 8147188
23445065 23445088 16 - 27260156 PANC1 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.73552169226039 [277] [125,209,118,131] -8 hSpCas9 negative selection 8204166
23434636 23434659 16 + 27260156 PANC1 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.049684825715857195 [676] [568,785,523,426] -1 hSpCas9 negative selection 8204167
23445104 23445127 16 - 27260156 PANC1 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.3317165466121592 [639] [689,993,554,593] 5 hSpCas9 negative selection 8204168
23434695 23434718 16 - 27260156 PANC1 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.08632569928177419 [437] [263,609,509,274] 1 hSpCas9 negative selection 8268437
23445896 23445919 16 - 27260156 PANC1 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.3787521880201852 [235] [192,129,71,209] -5 hSpCas9 negative selection 8268438
23445929 23445952 16 + 27260156 PANC1 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.016575666751088014 [606] [559,508,605,436] 0 hSpCas9 negative selection 8268439
23445065 23445088 16 - 27260156 PANC0813 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.013065857747555532 [277] [451,288,199,361] 0 hSpCas9 negative selection 8325417
23434636 23434659 16 + 27260156 PANC0813 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.20523737237468898 [676] [1158,699,1011,822] 3 hSpCas9 negative selection 8325418
23445104 23445127 16 - 27260156 PANC0813 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.4286794068276276 [639] [1197,973,1076,824] 7 hSpCas9 negative selection 8325419
23434695 23434718 16 - 27260156 PANC0813 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.48213881157400607 [437] [575,630,689,949] 7 hSpCas9 negative selection 8389688
23445896 23445919 16 - 27260156 PANC0813 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 0.25297812466702785 [235] [281,139,605,291] 4 hSpCas9 negative selection 8389689
23445929 23445952 16 + 27260156 PANC0813 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.005967696646758447 [606] [647,788,768,631] 0 hSpCas9 negative selection 8389690
23445065 23445088 16 - 27260156 RDES viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.2846071207788372 [277] [168,213,203,517] -5 hSpCas9 negative selection 8446668
23434636 23434659 16 + 27260156 RDES viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.08844711084764073 [676] [650,599,801,913] -1 hSpCas9 negative selection 8446669
23445104 23445127 16 - 27260156 RDES viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.6420724992271778 [639] [827,1015,1408,1446] 9 hSpCas9 negative selection 8446670
23434695 23434718 16 - 27260156 RDES viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.16966032063243408 [437] [611,465,575,596] 2 hSpCas9 negative selection 8510939
23445896 23445919 16 - 27260156 RDES viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.2544464974022702 [235] [183,200,189,358] -4 hSpCas9 negative selection 8510940
23445929 23445952 16 + 27260156 RDES viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.05748524321172771 [606] [569,799,724,830] 0 hSpCas9 negative selection 8510941
23445065 23445088 16 - 27260156 PC3 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 0.363781459740039 [277] [204,402,465,428] 7 hSpCas9 negative selection 8567919
23434636 23434659 16 + 27260156 PC3 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.0972156672664406 [676] [426,519,886,827] -2 hSpCas9 negative selection 8567920
23445104 23445127 16 - 27260156 PC3 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.28943525068022236 [639] [461,631,1494,889] 6 hSpCas9 negative selection 8567921
23434695 23434718 16 - 27260156 PC3 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.13684382171472662 [437] [434,313,610,579] 3 hSpCas9 negative selection 8632190
23445896 23445919 16 - 27260156 PC3 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.1022895224681395 [235] [143,191,323,271] -2 hSpCas9 negative selection 8632191
23445929 23445952 16 + 27260156 PC3 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.06518882118489411 [606] [395,698,592,875] 1 hSpCas9 negative selection 8632192
23445065 23445088 16 - 27260156 PATU8988T viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.6266672103185895 [277] [183,231,162,117] -7 hSpCas9 negative selection 8689170
23434636 23434659 16 + 27260156 PATU8988T viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.2618778544000893 [676] [576,489,317,816] -4 hSpCas9 negative selection 8689171
23445104 23445127 16 - 27260156 PATU8988T viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.2955542950120773 [639] [786,829,627,802] 5 hSpCas9 negative selection 8689172
23434695 23434718 16 - 27260156 PATU8988T viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 -0.3339223246146779 [437] [324,267,472,262] -5 hSpCas9 negative selection 8753441
23445896 23445919 16 - 27260156 PATU8988T viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.8131655960284547 [235] [53,215,158,94] -8 hSpCas9 negative selection 8753442
23445929 23445952 16 + 27260156 PATU8988T viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.2334599400880807 [606] [484,464,520,522] -4 hSpCas9 negative selection 8753443
23445065 23445088 16 - 27260156 T47D viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.0267802461208988 [277] [352,251,350,320] 0 hSpCas9 negative selection 8810421
23434636 23434659 16 + 27260156 T47D viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.1367519905240494 [676] [965,857,814,829] 3 hSpCas9 negative selection 8810422
23445104 23445127 16 - 27260156 T47D viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.3850950798955419 [639] [999,862,959,1084] 7 hSpCas9 negative selection 8810423
23434695 23434718 16 - 27260156 T47D viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.2968966069122217 [437] [576,536,782,614] 6 hSpCas9 negative selection 8874692
23445896 23445919 16 - 27260156 T47D viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.24833892741902175 [235] [190,167,306,264] -5 hSpCas9 negative selection 8874693
23445929 23445952 16 + 27260156 T47D viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.31667355231613387 [606] [875,804,880,969] 6 hSpCas9 negative selection 8874694
23445065 23445088 16 - 27260156 SU8686 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.18452217256589798 [277] [246,196,275,256] -3 hSpCas9 negative selection 8931672
23434636 23434659 16 + 27260156 SU8686 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.09313109922738083 [676] [641,614,654,1014] 1 hSpCas9 negative selection 8931673
23445104 23445127 16 - 27260156 SU8686 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.6062779379646459 [639] [830,853,1039,1201] 8 hSpCas9 negative selection 8931674
23434695 23434718 16 - 27260156 SU8686 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.16714421473632624 [437] [460,331,488,726] 3 hSpCas9 negative selection 8995943
23445896 23445919 16 - 27260156 SU8686 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.07260321324097396 [235] [185,211,226,277] -1 hSpCas9 negative selection 8995944
23445929 23445952 16 + 27260156 SU8686 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 0.20866323302316542 [606] [644,735,620,787] 3 hSpCas9 negative selection 8995945
23445065 23445088 16 - 27260156 SKES1 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.08052179668610548 [277] [281,294,301,182] -2 hSpCas9 negative selection 9052923
23434636 23434659 16 + 27260156 SKES1 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.04408697944000434 [676] [590,744,609,667] -1 hSpCas9 negative selection 9052924
23445104 23445127 16 - 27260156 SKES1 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.26152575042710113 [639] [865,1060,681,523] 5 hSpCas9 negative selection 9052925
23434695 23434718 16 - 27260156 SKES1 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.4253888841418033 [437] [846,621,509,422] 8 hSpCas9 negative selection 9117194
23445896 23445919 16 - 27260156 SKES1 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.663986220164769 [235] [94,188,208,101] -9 hSpCas9 negative selection 9117195
23445929 23445952 16 + 27260156 SKES1 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.20722710495076319 [606] [683,517,497,425] -4 hSpCas9 negative selection 9117196
23445065 23445088 16 - 27260156 TOV112D viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.6681937347927651 [277] [131,199,230,140] -8 hSpCas9 negative selection 9174174
23434636 23434659 16 + 27260156 TOV112D viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.32696042800098524 [676] [1356,905,633,567] 6 hSpCas9 negative selection 9174175
23445104 23445127 16 - 27260156 TOV112D viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.44180733193361343 [639] [1060,1318,589,643] 7 hSpCas9 negative selection 9174176
23434695 23434718 16 - 27260156 TOV112D viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.20251552670307016 [437] [555,569,491,422] 4 hSpCas9 negative selection 9238445
23445896 23445919 16 - 27260156 TOV112D viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.6180059847019803 [235] [172,194,160,99] -8 hSpCas9 negative selection 9238446
23445929 23445952 16 + 27260156 TOV112D viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.2577233102306011 [606] [378,776,449,482] -5 hSpCas9 negative selection 9238447
23445065 23445088 16 - 27260156 TC71 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.021297521816908804 [277] [254,250,320,350] 0 hSpCas9 negative selection 9295425
23434636 23434659 16 + 27260156 TC71 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 -0.12037138961363503 [676] [586,743,732,601] -3 hSpCas9 negative selection 9295426
23445104 23445127 16 - 27260156 TC71 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.3773462999498026 [639] [932,813,858,962] 8 hSpCas9 negative selection 9295427
23434695 23434718 16 - 27260156 TC71 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.16314755674698778 [437] [401,531,470,713] 4 hSpCas9 negative selection 9359696
23445896 23445919 16 - 27260156 TC71 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.31204359392377534 [235] [207,140,191,278] -7 hSpCas9 negative selection 9359697
23445929 23445952 16 + 27260156 TC71 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.02419913888452535 [606] [584,711,594,671] 0 hSpCas9 negative selection 9359698
23445065 23445088 16 - 27260156 TC32 viability CACGTTGAGCGCCGATATTGAGG COG7 ENSG00000168434 -0.47244210093960737 [277] [188,211,155,166] -7 hSpCas9 negative selection 9416676
23434636 23434659 16 + 27260156 TC32 viability CTTGTGACACTTGTAGTAGTAGG COG7 ENSG00000168434 0.17889024914876617 [676] [737,538,790,854] 3 hSpCas9 negative selection 9416677
23445104 23445127 16 - 27260156 TC32 viability ACTTGCTGCCGAATCTCTTCAGG COG7 ENSG00000168434 0.20456373011001772 [639] [667,454,842,896] 3 hSpCas9 negative selection 9416678
23434695 23434718 16 - 27260156 TC32 viability TCAGTCCAAAGTGTTTGTGAAGG COG7 ENSG00000168434 0.1596092290489956 [437] [397,377,594,504] 3 hSpCas9 negative selection 9480947
23445896 23445919 16 - 27260156 TC32 viability TGATGTTGAAGCCCTAAAACAGG COG7 ENSG00000168434 -0.5265721312934588 [235] [92,144,209,180] -7 hSpCas9 negative selection 9480948
23445929 23445952 16 + 27260156 TC32 viability TGGGCATGTTCTGGAGAGCTTGG COG7 ENSG00000168434 -0.2808266063892768 [606] [385,379,670,493] -5 hSpCas9 negative selection 9480949
23418741 23418764 16 + 27869803 HPAFII viability after 27 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.2820026185223322 [315] [110,157,NaN] -2 hSpCas9 negative selection 9556228
23424778 23424801 16 - 27869803 HPAFII viability after 27 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 -0.9185649063965925 [268] [16,122,NaN] -6 hSpCas9 negative selection 9556229
23433554 23433577 16 - 27869803 HPAFII viability after 27 days CTTGGCACACACAAATCCAGTGG COG7 ENSG00000168434 -0.7339814508674283 [544] [216,134,NaN] -5 hSpCas9 negative selection 9556230
23434641 23434664 16 + 27869803 HPAFII viability after 27 days GACACTTGTAGTAGTAGGCCAGG COG7 ENSG00000168434 0.5657596323648284 [24] [1,33,NaN] 4 hSpCas9 negative selection 9556231
23442496 23442519 16 + 27869803 HPAFII viability after 27 days TGCCGCTACAATCTGTGGACTGG COG7 ENSG00000168434 -0.15262604196221874 [310] [91,192,NaN] -1 hSpCas9 negative selection 9556232
23418741 23418764 16 + 27869803 HPAFII viability after 15 days CCATGTCGCCATACTTCAGCTGG COG7 ENSG00000168434 -0.20238918569472558 [315] [251,321,NaN] -2 hSpCas9 negative selection 9638677
23424778 23424801 16 - 27869803 HPAFII viability after 15 days GCCACCGCCCACTTCGCCAAGGG COG7 ENSG00000168434 -0.3428149656427584 [268] [132,286,NaN] -4 hSpCas9 negative selection 9638678
23433554 23433577 16 - 27869803 HPAFII viability after 15 days