Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 2521
  • Symbol: FUS
  • Description: FUS RNA binding protein
DataSource: http://genomecrispr.dkfz.de/#!/results/FUS

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
31184282 31184305 16 + 26472758 Jiyoye viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 -0.5775578618408161 [187] [94] -4 hSpCas9 negative selection 60442
31183866 31183889 16 + 26472758 Jiyoye viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 1.8789272717790388 [52] [146] 8 hSpCas9 negative selection 60443
31184998 31185021 16 + 26472758 Jiyoye viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 -1.1777871192152827 [95] [31] -7 hSpCas9 negative selection 60444
31185037 31185060 16 + 26472758 Jiyoye viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 0.6748711647095301 [205] [247] 5 hSpCas9 negative selection 60445
31185103 31185126 16 + 26472758 Jiyoye viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.5147038458103186 [167] [180] 4 hSpCas9 negative selection 60446
31185130 31185153 16 + 26472758 Jiyoye viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 -0.6284485282248478 [40] [19] -4 hSpCas9 negative selection 60447
31190105 31190128 16 + 26472758 Jiyoye viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 -1.752695955272516 [142] [31] -8 hSpCas9 negative selection 60448
31190328 31190351 16 + 26472758 Jiyoye viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 -1.0325241720072396 [235] [86] -6 hSpCas9 negative selection 60449
31191036 31191059 16 + 26472758 Jiyoye viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 -0.2642018710327559 [128] [80] -2 hSpCas9 negative selection 60450
31182401 31182424 16 + 26472758 Jiyoye viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.8745955869095062 [123] [50] -6 hSpCas9 negative selection 60451
31184282 31184305 16 + 26472758 KBM7 viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 0.4718490882596441 [470,309] [372,140] 5 hSpCas9 negative selection 251560
31183866 31183889 16 + 26472758 KBM7 viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.5510993973861366 [533,471] [119,197] -5 hSpCas9 negative selection 251561
31184998 31185021 16 + 26472758 KBM7 viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 -1.054661114993153 [190,262] [71,34] -7 hSpCas9 negative selection 251562
31185037 31185060 16 + 26472758 KBM7 viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 -0.09524826825565746 [1172,1181] [690,368] -1 hSpCas9 negative selection 251563
31185103 31185126 16 + 26472758 KBM7 viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.20980616520278716 [526,465] [361,186] 2 hSpCas9 negative selection 251564
31185130 31185153 16 + 26472758 KBM7 viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 -0.4072279114455446 [299,130] [97,51] -4 hSpCas9 negative selection 251565
31190105 31190128 16 + 26472758 KBM7 viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 -0.5928962914225542 [368,396] [102,135] -5 hSpCas9 negative selection 251566
31190328 31190351 16 + 26472758 KBM7 viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 -0.4204013010352096 [670,416] [215,161] -4 hSpCas9 negative selection 251567
31191036 31191059 16 + 26472758 KBM7 viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 -1.1451975518620372 [668,547] [115,139] -7 hSpCas9 negative selection 251568
31182401 31182424 16 + 26472758 KBM7 viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.818133232029334 [347,356] [92,95] -6 hSpCas9 negative selection 251569
31184282 31184305 16 + 26472758 Raji viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 0.4715398656502593 [201] [64] 4 hSpCas9 negative selection 442678
31183866 31183889 16 + 26472758 Raji viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.0231480277686259 [288] [65] 0 hSpCas9 negative selection 442679
31184998 31185021 16 + 26472758 Raji viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 -2.682693395252169 [82] [2] -9 hSpCas9 negative selection 442680
31185037 31185060 16 + 26472758 Raji viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 -0.2286986538236231 [716] [141] -2 hSpCas9 negative selection 442681
31185103 31185126 16 + 26472758 Raji viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 -0.10206983025535035 [221] [47] -1 hSpCas9 negative selection 442682
31185130 31185153 16 + 26472758 Raji viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 -0.5600411255395297 [107] [16] -4 hSpCas9 negative selection 442683
31190105 31190128 16 + 26472758 Raji viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 -2.6150824890974915 [263] [9] -9 hSpCas9 negative selection 442684
31190328 31190351 16 + 26472758 Raji viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 -0.08184202202764917 [300] [65] 0 hSpCas9 negative selection 442685
31191036 31191059 16 + 26472758 Raji viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 -0.45176977899795145 [276] [46] -4 hSpCas9 negative selection 442686
31182401 31182424 16 + 26472758 Raji viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.5446931612060935 [131] [20] -4 hSpCas9 negative selection 442687
31184282 31184305 16 + 26472758 K562 viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 0.1346147186617053 [422] [391] 1 hSpCas9 negative selection 633796
31183866 31183889 16 + 26472758 K562 viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 0.38901554916273495 [331] [366] 3 hSpCas9 negative selection 633797
31184998 31185021 16 + 26472758 K562 viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 -1.364390515009077 [121] [39] -6 hSpCas9 negative selection 633798
31185037 31185060 16 + 26472758 K562 viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 0.7838915299048204 [987] [1435] 6 hSpCas9 negative selection 633799
31185103 31185126 16 + 26472758 K562 viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.9697689071138709 [423] [700] 7 hSpCas9 negative selection 633800
31185130 31185153 16 + 26472758 K562 viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 0.04609001122046852 [108] [94] 0 hSpCas9 negative selection 633801
31190105 31190128 16 + 26472758 K562 viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 -1.1162264747937691 [320] [124] -6 hSpCas9 negative selection 633802
31190328 31190351 16 + 26472758 K562 viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 -0.5214116832207516 [487] [286] -3 hSpCas9 negative selection 633803
31191036 31191059 16 + 26472758 K562 viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 0.14112010246242884 [520] [484] 1 hSpCas9 negative selection 633804
31182401 31182424 16 + 26472758 K562 viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.9274363008742652 [186] [82] -5 hSpCas9 negative selection 633805
31180206 31180229 16 + 26627737 DLD1 viability TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.2291141928610516 [684] [259,255,238] 2 hSpCas9 negative selection 793890
31183993 31184016 16 - 26627737 DLD1 viability AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.4958016038384498 [741] [106,52,84] -8 hSpCas9 negative selection 793891
31186798 31186821 16 - 26627737 DLD1 viability GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 1.0472525984346002 [358] [273,194,225] 8 hSpCas9 negative selection 793892
31188318 31188341 16 + 26627737 DLD1 viability ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.6177161982879121 [245] [82,10,53] -6 hSpCas9 negative selection 793893
31189106 31189129 16 + 26627737 DLD1 viability CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 1.028077147077615 [786] [543,485,477] 8 hSpCas9 negative selection 793894
31180206 31180229 16 + 26627737 GBM cells viability after 5 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.06456024908920055 [467] [229,249] -1 hSpCas9 negative selection 876205
31183993 31184016 16 - 26627737 GBM cells viability after 5 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.19708794499166832 [232] [79,137] -3 hSpCas9 negative selection 876206
31186798 31186821 16 - 26627737 GBM cells viability after 5 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.15020389167900539 [238] [110,119] -2 hSpCas9 negative selection 876207
31188318 31188341 16 + 26627737 GBM cells viability after 5 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.853158611670729 [159] [30,63] -8 hSpCas9 negative selection 876208
31189106 31189129 16 + 26627737 GBM cells viability after 5 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.4074243151689687 [619] [465,415] 6 hSpCas9 negative selection 876209
31180206 31180229 16 + 26627737 GBM cells viability after 13 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.37838203854761066 [467] [339,321] 5 hSpCas9 negative selection 958520
31183993 31184016 16 - 26627737 GBM cells viability after 13 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 0.5882749864309248 [232] [183,194] 7 hSpCas9 negative selection 958521
31186798 31186821 16 - 26627737 GBM cells viability after 13 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.05986984582945393 [238] [178,79] 0 hSpCas9 negative selection 958522
31188318 31188341 16 + 26627737 GBM cells viability after 13 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.2118551746538777 [159] [53,91] -3 hSpCas9 negative selection 958523
31189106 31189129 16 + 26627737 GBM cells viability after 13 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.47899301630156366 [619] [464,471] 6 hSpCas9 negative selection 958524
31180206 31180229 16 + 26627737 GBM cells viability after 21 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.6674847687624439 [467] [395,410] 6 hSpCas9 negative selection 1040835
31183993 31184016 16 - 26627737 GBM cells viability after 21 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 1.390265542291194 [232] [347,316] 9 hSpCas9 negative selection 1040836
31186798 31186821 16 - 26627737 GBM cells viability after 21 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.40879648161261906 [238] [186,158] 4 hSpCas9 negative selection 1040837
31188318 31188341 16 + 26627737 GBM cells viability after 21 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 0.4409482540901374 [159] [117,117] 4 hSpCas9 negative selection 1040838
31189106 31189129 16 + 26627737 GBM cells viability after 21 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.57584402853826 [619] [523,481] 6 hSpCas9 negative selection 1040839
31180206 31180229 16 + 26627737 RPE1 viability after 9 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.1806611497331776 [1835] [483,536] -1 hSpCas9 negative selection 1123150
31183993 31184016 16 - 26627737 RPE1 viability after 9 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.0052621220923548 [1210] [187,189] -6 hSpCas9 negative selection 1123151
31186798 31186821 16 - 26627737 RPE1 viability after 9 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.1064335481849391 [839] [307,250] 0 hSpCas9 negative selection 1123152
31188318 31188341 16 + 26627737 RPE1 viability after 9 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 1.6611721191080433 [102] [125,70] 8 hSpCas9 negative selection 1123153
31189106 31189129 16 + 26627737 RPE1 viability after 9 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.9062888513202115 [1390] [875,738] 6 hSpCas9 negative selection 1123154
31180206 31180229 16 + 26627737 RPE1 viability after 12 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.015748133135826015 [1835] [504,491] 0 hSpCas9 negative selection 1205465
31183993 31184016 16 - 26627737 RPE1 viability after 12 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.105012275470759 [1210] [176,123] -6 hSpCas9 negative selection 1205466
31186798 31186821 16 - 26627737 RPE1 viability after 12 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.3145308608205689 [839] [489,58] 2 hSpCas9 negative selection 1205467
31188318 31188341 16 + 26627737 RPE1 viability after 12 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 1.5128697679332117 [102] [94,61] 8 hSpCas9 negative selection 1205468
31189106 31189129 16 + 26627737 RPE1 viability after 12 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.909120844645703 [1390] [864,528] 5 hSpCas9 negative selection 1205469
31180206 31180229 16 + 26627737 RPE1 viability after 15 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.2708078633227913 [1835] [487,374] -2 hSpCas9 negative selection 1287780
31183993 31184016 16 - 26627737 RPE1 viability after 15 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.6870885528130322 [1210] [140,72] -8 hSpCas9 negative selection 1287781
31186798 31186821 16 - 26627737 RPE1 viability after 15 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.32101998731646914 [839] [502,97] 2 hSpCas9 negative selection 1287782
31188318 31188341 16 + 26627737 RPE1 viability after 15 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 2.223167118113829 [102] [217,56] 9 hSpCas9 negative selection 1287783
31189106 31189129 16 + 26627737 RPE1 viability after 15 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.9162432361507852 [1390] [934,556] 5 hSpCas9 negative selection 1287784
31180206 31180229 16 + 26627737 RPE1 viability after 18 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.09906949583696156 [1835] [479,443] 0 hSpCas9 negative selection 1370095
31183993 31184016 16 - 26627737 RPE1 viability after 18 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.9075256863295411 [1210] [238,104] -5 hSpCas9 negative selection 1370096
31186798 31186821 16 - 26627737 RPE1 viability after 18 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.12344738836134878 [839] [312,95] 0 hSpCas9 negative selection 1370097
31188318 31188341 16 + 26627737 RPE1 viability after 18 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 1.8105331099192756 [102] [184,3] 8 hSpCas9 negative selection 1370098
31189106 31189129 16 + 26627737 RPE1 viability after 18 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.6729404315791333 [1390] [670,520] 4 hSpCas9 negative selection 1370099
31180206 31180229 16 + 26627737 HeLa viability after 8 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.11964961723831624 [792] [424,182,364] -1 hSpCas9 negative selection 1452410
31183993 31184016 16 - 26627737 HeLa viability after 8 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.9209131005154874 [398] [216,57,31] -7 hSpCas9 negative selection 1452411
31186798 31186821 16 - 26627737 HeLa viability after 8 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.08204782870133037 [586] [271,251,208] 0 hSpCas9 negative selection 1452412
31188318 31188341 16 + 26627737 HeLa viability after 8 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 0.710833444606675 [245] [318,162,81] 6 hSpCas9 negative selection 1452413
31189106 31189129 16 + 26627737 HeLa viability after 8 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.22151532889101522 [1009] [817,384,408] 2 hSpCas9 negative selection 1452414
31180206 31180229 16 + 26627737 HeLa viability after 12 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.0012076166438073077 [792] [385,374,217] 0 hSpCas9 negative selection 1534725
31183993 31184016 16 - 26627737 HeLa viability after 12 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.298258579594506 [398] [100,89,214] -3 hSpCas9 negative selection 1534726
31186798 31186821 16 - 26627737 HeLa viability after 12 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -2.245368714279393 [586] [1,79,66] -9 hSpCas9 negative selection 1534727
31188318 31188341 16 + 26627737 HeLa viability after 12 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 0.9878776915376901 [245] [219,129,262] 7 hSpCas9 negative selection 1534728
31189106 31189129 16 + 26627737 HeLa viability after 12 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.4832498926718449 [1009] [668,459,636] 4 hSpCas9 negative selection 1534729
31180206 31180229 16 + 26627737 HeLa viability after 15 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.06357711119362741 [792] [270,325,331] 0 hSpCas9 negative selection 1617040
31183993 31184016 16 - 26627737 HeLa viability after 15 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.8152818881114683 [398] [43,5,91] -9 hSpCas9 negative selection 1617041
31186798 31186821 16 - 26627737 HeLa viability after 15 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.6749347161663384 [586] [50,180,223] -5 hSpCas9 negative selection 1617042
31188318 31188341 16 + 26627737 HeLa viability after 15 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 0.8013168547195663 [245] [238,81,203] 6 hSpCas9 negative selection 1617043
31189106 31189129 16 + 26627737 HeLa viability after 15 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.2680723878873088 [1009] [569,327,593] 2 hSpCas9 negative selection 1617044
31180206 31180229 16 + 26627737 HeLa viability after 18 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.06786026658462174 [792] [167,284,331] 0 hSpCas9 negative selection 1699355
31183993 31184016 16 - 26627737 HeLa viability after 18 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.8265275760622146 [398] [27,5,91] -9 hSpCas9 negative selection 1699356
31186798 31186821 16 - 26627737 HeLa viability after 18 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.6607215653924676 [586] [32,154,223] -5 hSpCas9 negative selection 1699357
31188318 31188341 16 + 26627737 HeLa viability after 18 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 0.8747233654887485 [245] [173,72,203] 6 hSpCas9 negative selection 1699358
31189106 31189129 16 + 26627737 HeLa viability after 18 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.3121428378515432 [1009] [403,281,593] 2 hSpCas9 negative selection 1699359
31180206 31180229 16 + 26627737 HCT116 viability after 6 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.6367099088911 [1147] [433,195] 3 hSpCas9 negative selection 1781670
31183993 31184016 16 - 26627737 HCT116 viability after 6 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.6135673958053965 [998] [237,27] -4 hSpCas9 negative selection 1781671
31186798 31186821 16 - 26627737 HCT116 viability after 6 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.924280423246037 [573] [82,27] -5 hSpCas9 negative selection 1781672
31188318 31188341 16 + 26627737 HCT116 viability after 6 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 0.17219512531523185 [148] [66,3] 1 hSpCas9 negative selection 1781673
31189106 31189129 16 + 26627737 HCT116 viability after 6 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.25200044134930843 [1245] [240,228] 1 hSpCas9 negative selection 1781674
31180206 31180229 16 + 26627737 HCT116 viability after 8 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.20548887522202752 [544] [243,273,262] -2 hSpCas9 negative selection 1863985
31183993 31184016 16 - 26627737 HCT116 viability after 8 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.5345099008244433 [400] [225,165,67] -6 hSpCas9 negative selection 1863986
31186798 31186821 16 - 26627737 HCT116 viability after 8 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.0759433229813497 [371] [179,206,259] 0 hSpCas9 negative selection 1863987
31188318 31188341 16 + 26627737 HCT116 viability after 8 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.2644508505312835 [198] [101,75,95] -3 hSpCas9 negative selection 1863988
31189106 31189129 16 + 26627737 HCT116 viability after 8 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.12031591775587103 [639] [441,322,385] 1 hSpCas9 negative selection 1863989
31180206 31180229 16 + 26627737 HCT116 viability after 9 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.1515339399465907 [1147] [466,124] -1 hSpCas9 negative selection 1946300
31183993 31184016 16 - 26627737 HCT116 viability after 9 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -3.000457367385381 [998] [53,16] -9 hSpCas9 negative selection 1946301
31186798 31186821 16 - 26627737 HCT116 viability after 9 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.47662194344560527 [573] [410,56] 3 hSpCas9 negative selection 1946302
31188318 31188341 16 + 26627737 HCT116 viability after 9 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 2.037814994128984 [148] [197,135] 9 hSpCas9 negative selection 1946303
31189106 31189129 16 + 26627737 HCT116 viability after 9 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.19800273111092714 [1245] [570,231] 1 hSpCas9 negative selection 1946304
31180206 31180229 16 + 26627737 HCT116 viability after 12 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.19761261421283927 [544] [310,213,217] -2 hSpCas9 negative selection 2028615
31183993 31184016 16 - 26627737 HCT116 viability after 12 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.800611151733909 [400] [72,113,179] -7 hSpCas9 negative selection 2028616
31186798 31186821 16 - 26627737 HCT116 viability after 12 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.4255936908636721 [371] [437,166,164] 4 hSpCas9 negative selection 2028617
31188318 31188341 16 + 26627737 HCT116 viability after 12 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.02792464640567882 [198] [80,76,150] 0 hSpCas9 negative selection 2028618
31189106 31189129 16 + 26627737 HCT116 viability after 12 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.2362610535014995 [639] [376,468,345] 2 hSpCas9 negative selection 2028619
31180206 31180229 16 + 26627737 HCT116 viability after 15 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.39503550687569494 [544] [274,241,201] -4 hSpCas9 negative selection 2110930
31183993 31184016 16 - 26627737 HCT116 viability after 15 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.9454276888040283 [400] [103,144,107] -7 hSpCas9 negative selection 2110931
31186798 31186821 16 - 26627737 HCT116 viability after 15 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.5055455771821752 [371] [242,175,44] -5 hSpCas9 negative selection 2110932
31188318 31188341 16 + 26627737 HCT116 viability after 15 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 0.16926770283746362 [198] [140,112,132] 1 hSpCas9 negative selection 2110933
31189106 31189129 16 + 26627737 HCT116 viability after 15 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.4765959391524184 [639] [814,474,283] 4 hSpCas9 negative selection 2110934
31180206 31180229 16 + 26627737 HCT116 viability after 18 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.5681792073412939 [544] [188,216,121] -5 hSpCas9 negative selection 2193245
31183993 31184016 16 - 26627737 HCT116 viability after 18 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.7984095983106883 [400] [9,41,118] -8 hSpCas9 negative selection 2193246
31186798 31186821 16 - 26627737 HCT116 viability after 18 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 0.02259244266205468 [371] [278,134,134] 0 hSpCas9 negative selection 2193247
31188318 31188341 16 + 26627737 HCT116 viability after 18 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.6589262997619975 [198] [65,39,78] -6 hSpCas9 negative selection 2193248
31189106 31189129 16 + 26627737 HCT116 viability after 18 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.44235685197941943 [639] [489,539,213] 4 hSpCas9 negative selection 2193249
31180206 31180229 16 + 24336569 HL60 viability TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.05413123629454064 [618] [1359] 0 hSpCas9 negative selection 2267291
31180219 31180242 16 - 24336569 HL60 viability GCGCCCTTACCTACCGTTTGAGG FUS ENSG00000089280 1.3660649764390753 [342] [1870] 8 hSpCas9 negative selection 2267292
31182401 31182424 16 + 24336569 HL60 viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.13664701589820516 [905] [1743] -1 hSpCas9 negative selection 2267293
31180206 31180229 16 + 24336569 KBM7 viability TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.3636779389399372 [500] [1061] -3 hSpCas9 negative selection 2334468
31180219 31180242 16 - 24336569 KBM7 viability GCGCCCTTACCTACCGTTTGAGG FUS ENSG00000089280 -0.44002580211724757 [380] [765] -4 hSpCas9 negative selection 2334469
31182401 31182424 16 + 24336569 KBM7 viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.6640942260120185 [591] [1018] -5 hSpCas9 negative selection 2334470
31185079 31185102 16 + 25494202 A375 resistance to PLX-4720 (puromycin) GGTGGCGGCGGCGGCGGCGGCGG FUS ENSG00000089280 -1.372313513123184 [1,24] [0,0] -7 dCas9-VP64 positive selection 2468439
31193887 31193910 16 - 25494202 A375 resistance to PLX-4720 (puromycin) TTTGGGAGGCTGAGGCAGGCAGG FUS ENSG00000089280 0.6597088728489087 [159,20] [40,18] 3 dCas9-VP64 positive selection 2472698
31185079 31185102 16 + 25494202 A375 resistance to PLX-4720 (zeocin) GGTGGCGGCGGCGGCGGCGGCGG FUS ENSG00000089280 1.0093040069059924 [1,1] [0,0] 6 dCas9-VP64 positive selection 2563694
31193887 31193910 16 - 25494202 A375 resistance to PLX-4720 (zeocin) TTTGGGAGGCTGAGGCAGGCAGG FUS ENSG00000089280 0.628589961662267 [19,33] [6,18] 4 dCas9-VP64 positive selection 2567953
31185122 31185145 16 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity AGTGGTGGCTATGAACCCAGAGG FUS ENSG00000089280 -0.35138948428888495 [2,2] [2,0] -5 hSpCas9 positive selection 2989506
31182402 31182425 16 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 0.44740405364775643 [4,4] [6,5] 8 hSpCas9 positive selection 2989507
31183881 31183904 16 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CCAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.15017536726335182 [3,3] [4,2] 3 hSpCas9 positive selection 2989508
31183867 31183890 16 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.42874512313753765 [3,3] [0,2] -6 hSpCas9 positive selection 2989509
31185122 31185145 16 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity AGTGGTGGCTATGAACCCAGAGG FUS ENSG00000089280 0.027101695576803503 [2,2] [3,1] 0 hSpCas9 positive selection 3057364
31182402 31182425 16 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.13909936458242395 [4,4] [3,2] -2 hSpCas9 positive selection 3057365
31183881 31183904 16 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CCAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -0.07647372983124616 [3,3] [3,1] -1 hSpCas9 positive selection 3057366
31183867 31183890 16 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 0.4093355707862112 [3,3] [3,2] 7 hSpCas9 positive selection 3057367
31182401 31182424 + 24336571 A375 resistance to PLX after 7 days ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 0.017737459340329553 [4,8] [7,5] 0 hSpCas9 positive selection 3115519
31182401 31182424 + 24336571 A375 resistance to PLX after 14 days ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 0.2557754976210689 [1,10] [3,2] 2 hSpCas9 positive selection 3173312
31182401 31182424 + 24336571 A375 viability after 7 days ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -1.414204678299018 [19] [4,8] -9 hSpCas9 negative selection 3231105
31182401 31182424 + 24336571 A375 viability after 14 days ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -1.4730421115277985 [19] [1,10] -9 hSpCas9 negative selection 3288898
31183890 31183913 16 + 27383988 293T resistance to West Nile virus (flavivirus) TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 2.1296605657923355 [28,40] [0,0] 7 hSpCas9 positive selection 3350692
31183883 31183906 16 - 27383988 293T resistance to West Nile virus (flavivirus) CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -1.4319638120656264 [457,366] [0,0] -8 hSpCas9 positive selection 3350693
31184311 31184334 16 + 27383988 293T resistance to West Nile virus (flavivirus) GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.47596649792117546 [109,109] [0,0] 2 hSpCas9 positive selection 3369899
31184273 31184296 16 - 27383988 293T resistance to West Nile virus (flavivirus) TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.9472449328033686 [294,294] [0,0] -6 hSpCas9 positive selection 3369900
31185121 31185144 16 + 26780180 HT29 viability (Avana library 4 designs) AGTGGTGGCTATGAACCCAGAGG FUS ENSG00000089280 1.02912093548251 [] [] 4 hSpCas9 negative selection 3426457
31182401 31182424 16 + 26780180 HT29 viability (Avana library 4 designs) ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.265556812452375 [] [] -4 hSpCas9 negative selection 3426458
31183881 31183904 16 - 26780180 HT29 viability (Avana library 4 designs) CCAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.481039507720242 [] [] 1 hSpCas9 negative selection 3426459
31183866 31183889 16 + 26780180 HT29 viability (Avana library 4 designs) GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 0.679717234199743 [] [] 2 hSpCas9 negative selection 3426460
31183866 31183889 16 + 26780180 A375 viability (Avana lentiCRISPRv2) GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.257180114523597 [] [] 0 hSpCas9 negative selection 3509130
31185121 31185144 16 + 26780180 A375 viability (Avana lentiCRISPRv2) AGTGGTGGCTATGAACCCAGAGG FUS ENSG00000089280 -0.330782231335759 [] [] 0 hSpCas9 negative selection 3509131
31182401 31182424 16 + 26780180 A375 viability (Avana lentiCRISPRv2) ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -8.48140651792921 [] [] -7 hSpCas9 negative selection 3509132
31183881 31183904 16 - 26780180 A375 viability (Avana lentiCRISPRv2) CCAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.038696206531524 [] [] 0 hSpCas9 negative selection 3509133
31183866 31183889 16 + 26780180 A375 viability (Avana lentiGuide) GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.353433815853247 [] [] 0 hSpCas9 negative selection 3617789
31185121 31185144 16 + 26780180 A375 viability (Avana lentiGuide) AGTGGTGGCTATGAACCCAGAGG FUS ENSG00000089280 6.72254916892168 [] [] 5 hSpCas9 negative selection 3617790
31182401 31182424 16 + 26780180 A375 viability (Avana lentiGuide) ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 3.45063808562593 [] [] 3 hSpCas9 negative selection 3617791
31183881 31183904 16 - 26780180 A375 viability (Avana lentiGuide) CCAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 11.5387692681665 [] [] 7 hSpCas9 negative selection 3617792
31183866 31183889 16 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.46101314868465315 [5] [3,2] -6 hSpCas9 positive selection 3726448
31185121 31185144 16 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AGTGGTGGCTATGAACCCAGAGG FUS ENSG00000089280 -0.2761775897881436 [4] [6,1] -4 hSpCas9 positive selection 3726449
31182401 31182424 16 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.4499554185100378 [5] [4,3] -6 hSpCas9 positive selection 3726450
31183881 31183904 16 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CCAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -0.1777938246428528 [5] [3,4] -3 hSpCas9 positive selection 3726451
31183866 31183889 16 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 0.09886179886449963 [5] [5,4] 2 hSpCas9 positive selection 3835055
31185121 31185144 16 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AGTGGTGGCTATGAACCCAGAGG FUS ENSG00000089280 -0.6310719451967265 [5] [2,2] -7 hSpCas9 positive selection 3835056
31182401 31182424 16 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 0.08740167636117935 [6] [5,5] 2 hSpCas9 positive selection 3835057
31183881 31183904 16 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CCAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -0.1858108796491617 [4] [2,4] -3 hSpCas9 positive selection 3835058
31183883 31183906 16 - 26780180 A375 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 1.9178433131373 [] [] 9 hSpCas9 negative selection 3942228
31184311 31184334 16 + 26780180 A375 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 1.18299168994993 [] [] 6 hSpCas9 negative selection 3942229
31183890 31183913 16 + 26780180 A375 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 1.32946473791909 [] [] 7 hSpCas9 negative selection 3942230
31184273 31184296 16 - 26780180 A375 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 1.5161591712296 [] [] 8 hSpCas9 negative selection 3942231
31183883 31183906 16 - 26780180 HT29 viability (GeCKOv2 library) CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 1.45060429696375 [] [] 7 hSpCas9 negative selection 4050194
31184311 31184334 16 + 26780180 HT29 viability (GeCKOv2 library) GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 1.61083469542725 [] [] 8 hSpCas9 negative selection 4050195
31183890 31183913 16 + 26780180 HT29 viability (GeCKOv2 library) TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 1.05027349985457 [] [] 5 hSpCas9 negative selection 4050196
31184273 31184296 16 - 26780180 HT29 viability (GeCKOv2 library) TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.970468057738948 [] [] 4 hSpCas9 negative selection 4050197
31182401 31182424 16 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.16699879773928084 [2] [1,1] -4 hSpCas9 positive selection 4138623
31182401 31182424 16 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.7337124314185717 [4] [0,1,0,0] -8 hSpCas9 positive selection 4202645
31183890 31183913 16 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.26357752417295255 [2] [1,0] -5 hSpCas9 positive selection 4271864
31183883 31183906 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.3753839227744733 [4] [2,1] -7 hSpCas9 positive selection 4271865
31184311 31184334 16 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.15179045366784127 [2] [1,0] -3 hSpCas9 positive selection 4336126
31184273 31184296 16 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.23974219341168612 [3] [1,1] -5 hSpCas9 positive selection 4336127
31183881 31183903 16 - 27760321 OCIAML3 viability CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -0.3645691093844976 [492,384] [253,278] -4 hSpCas9 negative selection 4402305
31183928 31183950 16 - 27760321 OCIAML3 viability CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 -0.4036909048247779 [612,530] [269,424] -4 hSpCas9 negative selection 4402306
31184319 31184341 16 + 27760321 OCIAML3 viability ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.5674913402085303 [700,547] [737,693] 6 hSpCas9 negative selection 4402307
31184954 31184976 16 + 27760321 OCIAML3 viability ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -0.637192213627472 [295,231] [130,132] -6 hSpCas9 negative selection 4402308
31185104 31185126 16 + 27760321 OCIAML3 viability GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.08190624601908295 [569,432] [390,438] 0 hSpCas9 negative selection 4402309
31183881 31183903 16 - 27760321 OCIAML2 viability CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -0.3298730427756314 [492,384] [189,399] -4 hSpCas9 negative selection 4485768
31183928 31183950 16 - 27760321 OCIAML2 viability CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 -0.03533626425117592 [612,530] [335,600] 0 hSpCas9 negative selection 4485769
31184319 31184341 16 + 27760321 OCIAML2 viability ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.1627477889330171 [700,547] [480,667] 2 hSpCas9 negative selection 4485770
31184954 31184976 16 + 27760321 OCIAML2 viability ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -1.097237854311754 [295,231] [96,101] -8 hSpCas9 negative selection 4485771
31185104 31185126 16 + 27760321 OCIAML2 viability GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 -0.36359054557042136 [569,432] [276,359] -4 hSpCas9 negative selection 4485772
31183881 31183903 16 - 27760321 MV411 viability CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.9209094854588677 [492,384] [722,276] 6 hSpCas9 negative selection 4569231
31183928 31183950 16 - 27760321 MV411 viability CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 -0.5224845655947152 [612,530] [377,87] -4 hSpCas9 negative selection 4569232
31184319 31184341 16 + 27760321 MV411 viability ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 -0.8496748527210436 [700,547] [147,345] -5 hSpCas9 negative selection 4569233
31184954 31184976 16 + 27760321 MV411 viability ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -0.6920127992828607 [295,231] [7,255] -5 hSpCas9 negative selection 4569234
31185104 31185126 16 + 27760321 MV411 viability GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 -0.7981070867314388 [569,432] [207,159] -5 hSpCas9 negative selection 4569235
31183881 31183903 16 - 27760321 HL60 viability CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -1.3029219173693218 [492,384] [122,166] -8 hSpCas9 negative selection 4652694
31183928 31183950 16 - 27760321 HL60 viability CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.011515962598977525 [612,530] [511,424] 0 hSpCas9 negative selection 4652695
31184319 31184341 16 + 27760321 HL60 viability ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.02629198264614674 [700,547] [598,427] 0 hSpCas9 negative selection 4652696
31184954 31184976 16 + 27760321 HL60 viability ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -0.0032760574859170832 [295,231] [237,187] 0 hSpCas9 negative selection 4652697
31185104 31185126 16 + 27760321 HL60 viability GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.3598426973928255 [569,432] [605,431] 4 hSpCas9 negative selection 4652698
31183881 31183903 16 - 27760321 HT1080 viability CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -2.107975783366342 [384,300] [56,3] -6 hSpCas9 negative selection 4736157
31183928 31183950 16 - 27760321 HT1080 viability CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 1.0245620314329338 [530,414] [390,374] 5 hSpCas9 negative selection 4736158
31184319 31184341 16 + 27760321 HT1080 viability ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 -0.2711933045260904 [547,427] [120,204] -1 hSpCas9 negative selection 4736159
31184954 31184976 16 + 27760321 HT1080 viability ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -0.26540031364757644 [231,180] [24,115] -1 hSpCas9 negative selection 4736160
31185104 31185126 16 + 27760321 HT1080 viability GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 1.7956681155613512 [432,337] [736,309] 8 hSpCas9 negative selection 4736161
31183881 31183903 16 - 27760321 HT29 viability after 7 days CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.2178909231217075 [384,300] [579,496,471] 3 hSpCas9 negative selection 4819620
31183928 31183950 16 - 27760321 HT29 viability after 7 days CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.1830834933650473 [530,414] [651,627,781] 3 hSpCas9 negative selection 4819621
31184319 31184341 16 + 27760321 HT29 viability after 7 days ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.5318611541110644 [547,427] [804,1195,710] 7 hSpCas9 negative selection 4819622
31184954 31184976 16 + 27760321 HT29 viability after 7 days ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 0.4274322026532209 [231,180] [452,518,119] 6 hSpCas9 negative selection 4819623
31185104 31185126 16 + 27760321 HT29 viability after 7 days GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.42420469915618647 [432,337] [539,566,862] 6 hSpCas9 negative selection 4819624
31183881 31183903 16 - 27760321 HT29 viability after 25 days CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.9090706169635169 [384,300] [783,540,895] 9 hSpCas9 negative selection 4903083
31183928 31183950 16 - 27760321 HT29 viability after 25 days CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.8347826104643241 [530,414] [807,1059,1040] 8 hSpCas9 negative selection 4903084
31184319 31184341 16 + 27760321 HT29 viability after 25 days ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.44163016486396023 [547,427] [530,966,790] 5 hSpCas9 negative selection 4903085
31184954 31184976 16 + 27760321 HT29 viability after 25 days ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 0.15367234460963608 [231,180] [247,277,261] 1 hSpCas9 negative selection 4903086
31185104 31185126 16 + 27760321 HT29 viability after 25 days GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.6354246723963681 [432,337] [432,785,867] 7 hSpCas9 negative selection 4903087
31183881 31183903 16 - 27760321 HT29 viability after 22 days CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.5843370796072642 [384,300] [782,365,629] 6 hSpCas9 negative selection 4986546
31183928 31183950 16 - 27760321 HT29 viability after 22 days CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.654838045187127 [530,414] [643,1168,774] 7 hSpCas9 negative selection 4986547
31184319 31184341 16 + 27760321 HT29 viability after 22 days ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.3054867034013077 [547,427] [647,746,697] 3 hSpCas9 negative selection 4986548
31184954 31184976 16 + 27760321 HT29 viability after 22 days ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 0.4019423474152417 [231,180] [358,380,203] 4 hSpCas9 negative selection 4986549
31185104 31185126 16 + 27760321 HT29 viability after 22 days GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.7046497659531616 [432,337] [679,791,707] 7 hSpCas9 negative selection 4986550
31183881 31183903 16 - 27760321 HT29 viability after 19 days CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.6409620821746894 [384,300] [586,758,490] 6 hSpCas9 negative selection 5070009
31183928 31183950 16 - 27760321 HT29 viability after 19 days CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.5578206953122504 [530,414] [900,713,784] 5 hSpCas9 negative selection 5070010
31184319 31184341 16 + 27760321 HT29 viability after 19 days ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.4562604143551846 [547,427] [842,914,554] 4 hSpCas9 negative selection 5070011
31184954 31184976 16 + 27760321 HT29 viability after 19 days ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 0.20952873268229733 [231,180] [352,350,128] 2 hSpCas9 negative selection 5070012
31185104 31185126 16 + 27760321 HT29 viability after 19 days GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.38117832922139316 [432,337] [478,784,452] 3 hSpCas9 negative selection 5070013
31183881 31183903 16 - 27760321 HT29 viability after 16 days CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.8931080454608756 [384,300] [810,653,683] 9 hSpCas9 negative selection 5153472
31183928 31183950 16 - 27760321 HT29 viability after 16 days CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.8104080826569864 [530,414] [931,874,978] 8 hSpCas9 negative selection 5153473
31184319 31184341 16 + 27760321 HT29 viability after 16 days ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.6749052845306274 [547,427] [888,777,951] 7 hSpCas9 negative selection 5153474
31184954 31184976 16 + 27760321 HT29 viability after 16 days ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -0.005394008288157948 [231,180] [323,165,210] 0 hSpCas9 negative selection 5153475
31185104 31185126 16 + 27760321 HT29 viability after 16 days GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.5701414888690362 [432,337] [499,665,740] 6 hSpCas9 negative selection 5153476
31183881 31183903 16 - 27760321 HT29 viability after 13 days CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.21981980525511063 [384,300] [482,575,338] 2 hSpCas9 negative selection 5236935
31183928 31183950 16 - 27760321 HT29 viability after 13 days CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.515250755938204 [530,414] [758,810,782] 6 hSpCas9 negative selection 5236936
31184319 31184341 16 + 27760321 HT29 viability after 13 days ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.7015213892998922 [547,427] [912,1150,710] 8 hSpCas9 negative selection 5236937
31184954 31184976 16 + 27760321 HT29 viability after 13 days ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 0.36349062893163775 [231,180] [320,405,203] 4 hSpCas9 negative selection 5236938
31185104 31185126 16 + 27760321 HT29 viability after 13 days GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.3029107586972933 [432,337] [460,467,715] 4 hSpCas9 negative selection 5236939
31183881 31183903 16 - 27760321 HT29 viability after 10 days CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 0.6517967935659479 [384,300] [930,604,484] 8 hSpCas9 negative selection 5320398
31183928 31183950 16 - 27760321 HT29 viability after 10 days CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.45739159884618147 [530,414] [713,879,839] 6 hSpCas9 negative selection 5320399
31184319 31184341 16 + 27760321 HT29 viability after 10 days ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.7824245875721281 [547,427] [1129,951,1058] 9 hSpCas9 negative selection 5320400
31184954 31184976 16 + 27760321 HT29 viability after 10 days ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -0.41084166998991534 [231,180] [293,113,171] -5 hSpCas9 negative selection 5320401
31185104 31185126 16 + 27760321 HT29 viability after 10 days GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.506717493925737 [432,337] [513,809,729] 7 hSpCas9 negative selection 5320402
31183881 31183903 16 - 27760321 MOLM13 viability CAGTCGAGCCATATCCCTGGGG FUS ENSG00000089280 -1.652774567947 [492,384] [101,57] -7 hSpCas9 negative selection 5403861
31183928 31183950 16 - 27760321 MOLM13 viability CTGCTGCCCGTAAGACGATTGG FUS ENSG00000089280 0.23926945478456224 [612,530] [225,510] 1 hSpCas9 negative selection 5403862
31184319 31184341 16 + 27760321 MOLM13 viability ATAATCCCCCTCAGGGCTATGG FUS ENSG00000089280 0.7327847597936069 [700,547] [620,547] 5 hSpCas9 negative selection 5403863
31184954 31184976 16 + 27760321 MOLM13 viability ATCAATCCTCCATGAGTAGTGG FUS ENSG00000089280 -0.7756881819498315 [295,231] [147,33] -5 hSpCas9 negative selection 5403864
31185104 31185126 16 + 27760321 MOLM13 viability GTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.740192750610134 [569,432] [530,415] 5 hSpCas9 negative selection 5403865
31180153 31180176 16 + 27661255 K562 viability GCGTCGGTACTCAGCGGTGTTGG FUS ENSG00000089280 0.02340113326373694 [514,353] [400,315] 0 dCas9-KRAB negative selection 5481048
31183890 31183913 16 + 27260156 BXPC3 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.1517606802885385 [209] [190,187,203,208] -4 hSpCas9 negative selection 5544324
31183883 31183906 16 - 27260156 BXPC3 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.011450758274265116 [1283] [1203,1210,1563,1466] 0 hSpCas9 negative selection 5544325
31184311 31184334 16 + 27260156 BXPC3 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.12195455249281228 [203] [197,262,216,252] 2 hSpCas9 negative selection 5608586
31184273 31184296 16 - 27260156 BXPC3 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.10562976099394583 [477] [514,400,598,658] 2 hSpCas9 negative selection 5608587
31183890 31183913 16 + 27260156 A673 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.48486959376136496 [209] [139,150,213,212] -8 hSpCas9 negative selection 5665575
31183883 31183906 16 - 27260156 A673 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.21904056627268376 [1283] [1448,1294,1205,1363] -5 hSpCas9 negative selection 5665576
31184311 31184334 16 + 27260156 A673 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.07520674413859307 [203] [215,229,271,207] -2 hSpCas9 negative selection 5729837
31184273 31184296 16 - 27260156 A673 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.12338328031127385 [477] [615,430,474,601] -3 hSpCas9 negative selection 5729838
31183890 31183913 16 + 27260156 A375 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -1.0053199327853657 [209] [62,183,113,133] -8 hSpCas9 negative selection 5786826
31183883 31183906 16 - 27260156 A375 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.5790028016555124 [1283] [951,1191,1031,876] -7 hSpCas9 negative selection 5786827
31184311 31184334 16 + 27260156 A375 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.039750254276295305 [203] [239,338,215,201] 0 hSpCas9 negative selection 5851088
31184273 31184296 16 - 27260156 A375 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.6798036008923002 [477] [414,324,375,281] -7 hSpCas9 negative selection 5851089
31183890 31183913 16 + 27260156 COLO741 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.43182321676844726 [209] [163,210,216] -7 hSpCas9 negative selection 5908077
31183883 31183906 16 - 27260156 COLO741 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.20427811704454246 [1283] [1577,1481,1235] -4 hSpCas9 negative selection 5908078
31184311 31184334 16 + 27260156 COLO741 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.0730012897749357 [203] [290,197,329] 1 hSpCas9 negative selection 5972339
31184273 31184296 16 - 27260156 COLO741 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.07345715154080462 [477] [729,564,638] 1 hSpCas9 negative selection 5972340
31183890 31183913 16 + 27260156 CAL120 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.6432600572766349 [209] [297,137,86] -7 hSpCas9 negative selection 6029328
31183883 31183906 16 - 27260156 CAL120 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.3808328867286104 [1283] [1480,1067,1170] -5 hSpCas9 negative selection 6029329
31184311 31184334 16 + 27260156 CAL120 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.8243945020158514 [203] [207,158,73] -8 hSpCas9 negative selection 6093590
31184273 31184296 16 - 27260156 CAL120 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.22077735315994262 [477] [746,385,434] -3 hSpCas9 negative selection 6093591
31183890 31183913 16 + 27260156 CADOES1 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -1.1529340496992238 [209] [89,72,107,79] -9 hSpCas9 negative selection 6150579
31183883 31183906 16 - 27260156 CADOES1 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.1639651360468537 [1283] [1011,1182,1002,1065] -3 hSpCas9 negative selection 6150580
31184311 31184334 16 + 27260156 CADOES1 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.10396652528936756 [203] [170,282,111,138] -2 hSpCas9 negative selection 6214841
31184273 31184296 16 - 27260156 CADOES1 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.07799113661410867 [477] [506,523,429,413] 1 hSpCas9 negative selection 6214842
31183890 31183913 16 + 27260156 EWS502 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.5571337026886496 [209] [136,134,246,83] -7 hSpCas9 negative selection 6271830
31183883 31183906 16 - 27260156 EWS502 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.26884435086762104 [1283] [962,1031,1056,1508] -5 hSpCas9 negative selection 6271831
31184311 31184334 16 + 27260156 EWS502 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.41615678773640674 [203] [115,188,198,146] -6 hSpCas9 negative selection 6336092
31184273 31184296 16 - 27260156 EWS502 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.13572830989727025 [477] [568,527,561,563] 2 hSpCas9 negative selection 6336093
31183890 31183913 16 + 27260156 EW8 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -1.243775132787132 [209] [94,92,35,71] -9 hSpCas9 negative selection 6393081
31183883 31183906 16 - 27260156 EW8 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.4222634436341972 [1283] [1122,574,682,775] -7 hSpCas9 negative selection 6393082
31184311 31184334 16 + 27260156 EW8 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.3633805228644438 [203] [192,57,154,109] -6 hSpCas9 negative selection 6457343
31184273 31184296 16 - 27260156 EW8 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.6116777172841186 [477] [263,220,194,343] -8 hSpCas9 negative selection 6457344
31183890 31183913 16 + 27260156 CORL105 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.7877033763551109 [209] [153,108,163,146] -8 hSpCas9 negative selection 6514332
31183883 31183906 16 - 27260156 CORL105 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.31206402320435456 [1283] [1385,933,1493,1084] -5 hSpCas9 negative selection 6514333
31184311 31184334 16 + 27260156 CORL105 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.48775246237492875 [203] [182,186,223,95] -7 hSpCas9 negative selection 6578594
31184273 31184296 16 - 27260156 CORL105 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.021086290928712982 [477] [401,677,648,546] 0 hSpCas9 negative selection 6578595
31183890 31183913 16 + 27260156 HS294T viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -1.1138646501782825 [209] [38,33,33,43] -9 hSpCas9 negative selection 6635583
31183883 31183906 16 - 27260156 HS294T viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.002150630670867848 [1283] [373,398,409,883] 0 hSpCas9 negative selection 6635584
31184311 31184334 16 + 27260156 HS294T viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.37009038829906893 [203] [31,67,67,81] -5 hSpCas9 negative selection 6699845
31184273 31184296 16 - 27260156 HS294T viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.0597385808176532 [477] [109,192,242,166] -1 hSpCas9 negative selection 6699846
31183890 31183913 16 + 27260156 HCC44 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 0.18845319027144525 [209] [472,203,275,159] 3 hSpCas9 negative selection 6756834
31183883 31183906 16 - 27260156 HCC44 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.08870481777168182 [1283] [1355,1414,1906,1549] 1 hSpCas9 negative selection 6756835
31184311 31184334 16 + 27260156 HCC44 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.07997012828251227 [203] [196,156,261,267] -1 hSpCas9 negative selection 6821096
31184273 31184296 16 - 27260156 HCC44 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.4736037339854954 [477] [855,516,774,890] 7 hSpCas9 negative selection 6821097
31183890 31183913 16 + 27260156 G402 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.7291698659772643 [209] [200,48,122,240] -7 hSpCas9 negative selection 6878085
31183883 31183906 16 - 27260156 G402 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.5220139154525734 [1283] [960,1170,1060,1149] -6 hSpCas9 negative selection 6878086
31184311 31184334 16 + 27260156 G402 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.2881782829712245 [203] [194,80,67,449] -4 hSpCas9 negative selection 6942347
31184273 31184296 16 - 27260156 G402 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.5512463375138185 [477] [380,279,325,584] -6 hSpCas9 negative selection 6942348
31183890 31183913 16 + 27260156 L33 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.5717427351236717 [209] [155,11,146,145] -8 hSpCas9 negative selection 6999336
31183883 31183906 16 - 27260156 L33 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.008550999960280858 [1283] [1208,649,806,1090] 0 hSpCas9 negative selection 6999337
31184311 31184334 16 + 27260156 L33 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.04605905833485613 [203] [192,57,160,251] 1 hSpCas9 negative selection 7063598
31184273 31184296 16 - 27260156 L33 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.19115440173303064 [477] [527,235,301,597] 4 hSpCas9 negative selection 7063599
31183890 31183913 16 + 27260156 K562 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.6829752831794609 [209] [23,164,107,156] -7 hSpCas9 negative selection 7120587
31183883 31183906 16 - 27260156 K562 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.09333368424235644 [1283] [1799,1275,1283,618] 1 hSpCas9 negative selection 7120588
31184311 31184334 16 + 27260156 K562 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.30257660423715627 [203] [261,142,102,93] -4 hSpCas9 negative selection 7184849
31184273 31184296 16 - 27260156 K562 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.17756007975624533 [477] [645,148,815,320] 2 hSpCas9 negative selection 7184850
31183890 31183913 16 + 27260156 HT29 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 0.015854284868828783 [209] [265,241,265,255] 0 hSpCas9 negative selection 7241838
31183883 31183906 16 - 27260156 HT29 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.032321593841310836 [1283] [1656,1738,1719,1309] 0 hSpCas9 negative selection 7241839
31184311 31184334 16 + 27260156 HT29 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.022001294448182218 [203] [225,251,323,206] 0 hSpCas9 negative selection 7306100
31184273 31184296 16 - 27260156 HT29 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.09836400539116832 [477] [725,678,589,514] 2 hSpCas9 negative selection 7306101
31183890 31183913 16 + 27260156 MHHES1 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.2647063403364247 [209] [153,285,192,161] -5 hSpCas9 negative selection 7363089
31183883 31183906 16 - 27260156 MHHES1 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.22862064434255114 [1283] [1085,1552,1441,917] -4 hSpCas9 negative selection 7363090
31184311 31184334 16 + 27260156 MHHES1 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.14344199667434387 [203] [422,216,226,176] 2 hSpCas9 negative selection 7427351
31184273 31184296 16 - 27260156 MHHES1 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.10512232623173379 [477] [434,845,356,401] -2 hSpCas9 negative selection 7427352
31183890 31183913 16 + 27260156 MEWO viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.3890823820715057 [209] [174,125,153] -7 hSpCas9 negative selection 7484340
31183883 31183906 16 - 27260156 MEWO viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.3423065637100511 [1283] [996,939,914] -6 hSpCas9 negative selection 7484341
31184311 31184334 16 + 27260156 MEWO viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.13711872011511095 [203] [257,194,185] 3 hSpCas9 negative selection 7548602
31184273 31184296 16 - 27260156 MEWO viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.06676224960821081 [477] [519,396,381] -1 hSpCas9 negative selection 7548603
31183890 31183913 16 + 27260156 LNCAPCLONEFGC viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.2543300137765703 [209] [218,164,116,128] -4 hSpCas9 negative selection 7605591
31183883 31183906 16 - 27260156 LNCAPCLONEFGC viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.08971057102548641 [1283] [1031,930,1300,1149] -1 hSpCas9 negative selection 7605592
31184311 31184334 16 + 27260156 LNCAPCLONEFGC viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.3982248713022647 [203] [225,229,268,253] 6 hSpCas9 negative selection 7669853
31184273 31184296 16 - 27260156 LNCAPCLONEFGC viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.037442701217608884 [477] [378,481,487,344] 0 hSpCas9 negative selection 7669854
31183890 31183913 16 + 27260156 PANC0327 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 0.12609423544941345 [209] [90,320,245,131] 1 hSpCas9 negative selection 7726842
31183883 31183906 16 - 27260156 PANC0327 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.047773902779354005 [1283] [1224,1044,1122,1037] 0 hSpCas9 negative selection 7726843
31184311 31184334 16 + 27260156 PANC0327 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.03481403728550636 [203] [91,281,167,144] 0 hSpCas9 negative selection 7791104
31184273 31184296 16 - 27260156 PANC0327 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.20633441585059542 [477] [626,377,436,542] 3 hSpCas9 negative selection 7791105
31183890 31183913 16 + 27260156 NCIH2009 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -1.0493570571943331 [209] [153,57,216] -8 hSpCas9 negative selection 7848093
31183883 31183906 16 - 27260156 NCIH2009 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.09794606357487035 [1283] [1893,2113,1739] 1 hSpCas9 negative selection 7848094
31184311 31184334 16 + 27260156 NCIH2009 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.5138173950535653 [203] [597,458,199] 7 hSpCas9 negative selection 7912355
31184273 31184296 16 - 27260156 NCIH2009 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.08136541001018335 [477] [799,597,740] 1 hSpCas9 negative selection 7912356
31183890 31183913 16 + 27260156 NCIH1373 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.7736687863228453 [209] [85,113,282,13] -7 hSpCas9 negative selection 7969344
31183883 31183906 16 - 27260156 NCIH1373 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.22814702618291638 [1283] [2256,1482,1207,504] 2 hSpCas9 negative selection 7969345
31184311 31184334 16 + 27260156 NCIH1373 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.10578319126996405 [203] [576,62,99,47] -1 hSpCas9 negative selection 8033606
31184273 31184296 16 - 27260156 NCIH1373 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.46027271202331715 [477] [398,441,312,104] -4 hSpCas9 negative selection 8033607
31183890 31183913 16 + 27260156 PATU8902 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.8763765640767363 [209] [128,150,69,329] -7 hSpCas9 negative selection 8090595
31183883 31183906 16 - 27260156 PATU8902 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.12276546543378264 [1283] [2107,1357,938,2419] -1 hSpCas9 negative selection 8090596
31184311 31184334 16 + 27260156 PATU8902 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.10356473716936465 [203] [268,360,305,279] 1 hSpCas9 negative selection 8154857
31184273 31184296 16 - 27260156 PATU8902 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.02013880800167331 [477] [586,752,701,555] 0 hSpCas9 negative selection 8154858
31183890 31183913 16 + 27260156 PANC1 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.5681680233781139 [209] [126,130,104,122] -7 hSpCas9 negative selection 8211846
31183883 31183906 16 - 27260156 PANC1 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.4075688427734201 [1283] [905,889,766,768] -6 hSpCas9 negative selection 8211847
31184311 31184334 16 + 27260156 PANC1 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.049347464421542364 [203] [234,287,82,101] -1 hSpCas9 negative selection 8276108
31184273 31184296 16 - 27260156 PANC1 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.18685580902340576 [477] [443,586,328,516] 3 hSpCas9 negative selection 8276109
31183890 31183913 16 + 27260156 PANC0813 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.6624055448685464 [209] [89,309,68,147] -7 hSpCas9 negative selection 8333097
31183883 31183906 16 - 27260156 PANC0813 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.13584139421064645 [1283] [2088,1661,1738,1201] 2 hSpCas9 negative selection 8333098
31184311 31184334 16 + 27260156 PANC0813 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.3381223707226493 [203] [224,164,126,240] -5 hSpCas9 negative selection 8397359
31184273 31184296 16 - 27260156 PANC0813 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.04859617669115574 [477] [732,421,631,550] 0 hSpCas9 negative selection 8397360
31183890 31183913 16 + 27260156 RDES viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.47599562404236795 [209] [179,141,158,214] -7 hSpCas9 negative selection 8454348
31183883 31183906 16 - 27260156 RDES viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.1106483826200988 [1283] [1061,1254,1634,1600] -2 hSpCas9 negative selection 8454349
31184311 31184334 16 + 27260156 RDES viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.2004275899301542 [203] [132,178,246,283] -3 hSpCas9 negative selection 8518610
31184273 31184296 16 - 27260156 RDES viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.1406596109544075 [477] [344,573,748,841] 2 hSpCas9 negative selection 8518611
31183890 31183913 16 + 27260156 PC3 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.3098153100527834 [209] [93,190,333,135] -6 hSpCas9 negative selection 8575599
31183883 31183906 16 - 27260156 PC3 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.3336796688043202 [1283] [607,1052,1860,947] -6 hSpCas9 negative selection 8575600
31184311 31184334 16 + 27260156 PC3 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.05318476980687792 [203] [98,313,277,204] 1 hSpCas9 negative selection 8639861
31184273 31184296 16 - 27260156 PC3 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.2743775285970181 [477] [191,364,750,469] -6 hSpCas9 negative selection 8639862
31183890 31183913 16 + 27260156 PATU8988T viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.06502126550439713 [209] [248,173,191,155] -1 hSpCas9 negative selection 8696850
31183883 31183906 16 - 27260156 PATU8988T viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.2255792185753922 [1283] [1210,1154,695,1207] -4 hSpCas9 negative selection 8696851
31184311 31184334 16 + 27260156 PATU8988T viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.013706915426318744 [203] [126,198,269,198] 0 hSpCas9 negative selection 8761112
31184273 31184296 16 - 27260156 PATU8988T viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.29860447712339655 [477] [522,842,589,321] 5 hSpCas9 negative selection 8761113
31183890 31183913 16 + 27260156 T47D viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.4767379916422114 [209] [154,190,152,203] -7 hSpCas9 negative selection 8818101
31183883 31183906 16 - 27260156 T47D viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.16086557538996926 [1283] [1369,1355,1346,1274] -4 hSpCas9 negative selection 8818102
31184311 31184334 16 + 27260156 T47D viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.11485998425046784 [203] [255,236,190,191] -3 hSpCas9 negative selection 8882363
31184273 31184296 16 - 27260156 T47D viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 0.09787851650836266 [477] [653,613,569,542] 2 hSpCas9 negative selection 8882364
31183890 31183913 16 + 27260156 SU8686 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.4929127409956888 [209] [67,200,149,178] -7 hSpCas9 negative selection 8939352
31183883 31183906 16 - 27260156 SU8686 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 0.012086296275080288 [1283] [1212,1137,1318,1521] 0 hSpCas9 negative selection 8939353
31184311 31184334 16 + 27260156 SU8686 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.08619521868324398 [203] [148,196,201,221] -1 hSpCas9 negative selection 9003614
31184273 31184296 16 - 27260156 SU8686 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.4153655848221743 [477] [344,289,289,529] -6 hSpCas9 negative selection 9003615
31183890 31183913 16 + 27260156 SKES1 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.9893244215348742 [209] [129,121,91,84] -9 hSpCas9 negative selection 9060603
31183883 31183906 16 - 27260156 SKES1 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.364338511448834 [1283] [931,1083,1212,766] -7 hSpCas9 negative selection 9060604
31184311 31184334 16 + 27260156 SKES1 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.049139438537165514 [203] [198,270,233,100] -1 hSpCas9 negative selection 9124865
31184273 31184296 16 - 27260156 SKES1 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.191870078154139 [477] [399,524,386,369] -4 hSpCas9 negative selection 9124866
31183890 31183913 16 + 27260156 TOV112D viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.5102019886418045 [209] [45,366,79,142] -7 hSpCas9 negative selection 9181854
31183883 31183906 16 - 27260156 TOV112D viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.3644790302960692 [1283] [1290,1145,737,882] -6 hSpCas9 negative selection 9181855
31184311 31184334 16 + 27260156 TOV112D viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.13343128341469934 [203] [286,228,178,71] -3 hSpCas9 negative selection 9246116
31184273 31184296 16 - 27260156 TOV112D viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.0993048019126471 [477] [359,594,414,445] -2 hSpCas9 negative selection 9246117
31183890 31183913 16 + 27260156 TC71 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.574574984274189 [209] [118,130,188,165] -9 hSpCas9 negative selection 9303105
31183883 31183906 16 - 27260156 TC71 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.3446070416642566 [1283] [1004,1133,1007,1199] -7 hSpCas9 negative selection 9303106
31184311 31184334 16 + 27260156 TC71 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 -0.19976503515004795 [203] [149,173,202,237] -5 hSpCas9 negative selection 9367367
31184273 31184296 16 - 27260156 TC71 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.07860038382524945 [477] [601,557,371,404] -2 hSpCas9 negative selection 9367368
31183890 31183913 16 + 27260156 TC32 viability TATGGCTCGACTGGCGGCTATGG FUS ENSG00000089280 -0.6890757794359434 [209] [125,97,145,124] -8 hSpCas9 negative selection 9424356
31183883 31183906 16 - 27260156 TC32 viability CGCCAGTCGAGCCATATCCCTGG FUS ENSG00000089280 -0.14845635484714137 [1283] [1157,747,1482,1088] -3 hSpCas9 negative selection 9424357
31184311 31184334 16 + 27260156 TC32 viability GCAAAGCTATAATCCCCCTCAGG FUS ENSG00000089280 0.17277659756854113 [203] [123,138,336,320] 3 hSpCas9 negative selection 9488618
31184273 31184296 16 - 27260156 TC32 viability TGCTGCTGTCCACCATAGCTAGG FUS ENSG00000089280 -0.18556869353507163 [477] [324,266,595,465] -3 hSpCas9 negative selection 9488619
31180206 31180229 16 + 27869803 HPAFII viability after 27 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.7814677540421693 [436] [647,183,NaN] 6 hSpCas9 negative selection 9556902
31183993 31184016 16 - 27869803 HPAFII viability after 27 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.9419647849011521 [194] [108,6,NaN] -6 hSpCas9 negative selection 9556903
31186798 31186821 16 - 27869803 HPAFII viability after 27 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -1.1422448801383436 [278] [66,65,NaN] -7 hSpCas9 negative selection 9556904
31188318 31188341 16 + 27869803 HPAFII viability after 27 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -2.1846857778752087 [135] [0,27,NaN] -8 hSpCas9 negative selection 9556905
31189106 31189129 16 + 27869803 HPAFII viability after 27 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 1.1382406097719746 [642] [502,944,NaN] 8 hSpCas9 negative selection 9556906
31180206 31180229 16 + 27869803 HPAFII viability after 15 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.7698827911935147 [436] [1081,625,NaN] 8 hSpCas9 negative selection 9639351
31183993 31184016 16 - 27869803 HPAFII viability after 15 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.722900922636118 [194] [216,70,NaN] -6 hSpCas9 negative selection 9639352
31186798 31186821 16 - 27869803 HPAFII viability after 15 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -1.631971704796905 [278] [224,16,NaN] -8 hSpCas9 negative selection 9639353
31188318 31188341 16 + 27869803 HPAFII viability after 15 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.11390422938005762 [135] [139,131,NaN] -1 hSpCas9 negative selection 9639354
31189106 31189129 16 + 27869803 HPAFII viability after 15 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.6255696499504835 [642] [1252,949,NaN] 7 hSpCas9 negative selection 9639355
31180206 31180229 16 + 27869803 ASPC1 viability after 36 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.005288164787274785 [974] [304,315,383] 0 hSpCas9 negative selection 9721800
31183993 31184016 16 - 27869803 ASPC1 viability after 36 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.015473632829582779 [700] [327,380,68] 0 hSpCas9 negative selection 9721801
31186798 31186821 16 - 27869803 ASPC1 viability after 36 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.7169091479562324 [840] [262,143,144] -6 hSpCas9 negative selection 9721802
31188318 31188341 16 + 27869803 ASPC1 viability after 36 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -0.07663386736490363 [339] [317,69,0] -1 hSpCas9 negative selection 9721803
31189106 31189129 16 + 27869803 ASPC1 viability after 36 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 -0.40656136794570275 [1414] [534,384,244] -4 hSpCas9 negative selection 9721804
31180206 31180229 16 + 27869803 PATU8988S viability after 35 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.46108611058686455 [1070] [245,380,NaN] -5 hSpCas9 negative selection 9804249
31183993 31184016 16 - 27869803 PATU8988S viability after 35 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 0.2726283858480794 [526] [211,300,NaN] 3 hSpCas9 negative selection 9804250
31186798 31186821 16 - 27869803 PATU8988S viability after 35 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.4298607409080596 [575] [44,299,NaN] -4 hSpCas9 negative selection 9804251
31188318 31188341 16 + 27869803 PATU8988S viability after 35 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 1.2399196191601651 [230] [322,115,NaN] 9 hSpCas9 negative selection 9804252
31189106 31189129 16 + 27869803 PATU8988S viability after 35 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.11106078116683538 [1063] [382,542,NaN] 1 hSpCas9 negative selection 9804253
31180206 31180229 16 + 27869803 PATU8988S viability after 31 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 -0.1250854016126829 [1070] [329,469,NaN] -1 hSpCas9 negative selection 9886698
31183993 31184016 16 - 27869803 PATU8988S viability after 31 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 0.1379867325885099 [526] [177,298,NaN] 1 hSpCas9 negative selection 9886699
31186798 31186821 16 - 27869803 PATU8988S viability after 31 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -0.42010603397391705 [575] [40,337,NaN] -5 hSpCas9 negative selection 9886700
31188318 31188341 16 + 27869803 PATU8988S viability after 31 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 1.141230008842466 [230] [229,168,NaN] 9 hSpCas9 negative selection 9886701
31189106 31189129 16 + 27869803 PATU8988S viability after 31 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.45664456361673156 [1063] [561,607,NaN] 5 hSpCas9 negative selection 9886702
31180206 31180229 16 + 27869803 HPAFII viability after 35 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.7008038924792939 [436] [479,223,NaN] 4 hSpCas9 negative selection 9969147
31183993 31184016 16 - 27869803 HPAFII viability after 35 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -1.004724892854439 [194] [91,0,NaN] -5 hSpCas9 negative selection 9969148
31186798 31186821 16 - 27869803 HPAFII viability after 35 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -1.4353558875636 [278] [31,74,NaN] -6 hSpCas9 negative selection 9969149
31188318 31188341 16 + 27869803 HPAFII viability after 35 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -3.3732638537118067 [135] [0,12,NaN] -8 hSpCas9 negative selection 9969150
31189106 31189129 16 + 27869803 HPAFII viability after 35 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.9134731352274101 [642] [289,976,NaN] 6 hSpCas9 negative selection 9969151
31180206 31180229 16 + 27869803 HPAFII viability after 31 days TGCGCGGACATGGCCTCAAACGG FUS ENSG00000089280 0.3908451035680134 [436] [456,173,NaN] 3 hSpCas9 negative selection 10051596
31183993 31184016 16 - 27869803 HPAFII viability after 31 days AACACCACCGTACCTTCCCGAGG FUS ENSG00000089280 -0.620588041292899 [194] [130,5,NaN] -4 hSpCas9 negative selection 10051597
31186798 31186821 16 - 27869803 HPAFII viability after 31 days GCCACCACGGTCACTTCCGCTGG FUS ENSG00000089280 -1.3475655208570376 [278] [50,72,NaN] -7 hSpCas9 negative selection 10051598
31188318 31188341 16 + 27869803 HPAFII viability after 31 days ACTAAAGGCCCTCGGGACCAAGG FUS ENSG00000089280 -1.3610068454915933 [135] [0,60,NaN] -7 hSpCas9 negative selection 10051599
31189106 31189129 16 + 27869803 HPAFII viability after 31 days CTCTGTTCAACAAGCAGAACAGG FUS ENSG00000089280 0.7256791234290871 [642] [378,833,NaN] 5 hSpCas9 negative selection 10051600
31184282 31184305 16 + 28162770 P31FUJ viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 0.8000410522726387 [151] [310] 8 hSpCas9 negative selection 10159451
31183866 31183889 16 + 28162770 P31FUJ viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -1.2725483832071351 [367] [178] -7 hSpCas9 negative selection 10159452
31184998 31185021 16 + 28162770 P31FUJ viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 -0.28010791919273537 [61] [59] -3 hSpCas9 negative selection 10159453
31185037 31185060 16 + 28162770 P31FUJ viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 -0.5732009028004666 [451] [356] -5 hSpCas9 negative selection 10159454
31185103 31185126 16 + 28162770 P31FUJ viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 -0.27836478179482255 [192] [186] -3 hSpCas9 negative selection 10159455
31185130 31185153 16 + 28162770 P31FUJ viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 -0.05664524926055181 [76] [86] 0 hSpCas9 negative selection 10159456
31190105 31190128 16 + 28162770 P31FUJ viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 -1.0907831995419508 [260] [143] -6 hSpCas9 negative selection 10159457
31190328 31190351 16 + 28162770 P31FUJ viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 -0.4267440869752267 [317] [277] -4 hSpCas9 negative selection 10159458
31191036 31191059 16 + 28162770 P31FUJ viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 -0.6425062593901817 [359] [270] -5 hSpCas9 negative selection 10159459
31182401 31182424 16 + 28162770 P31FUJ viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.6790584343039427 [217] [159] -5 hSpCas9 negative selection 10159460
31184282 31184305 16 + 28162770 TF1 viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 NaN [NaN] [193] 1 hSpCas9 negative selection 10328817
31183866 31183889 16 + 28162770 TF1 viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 NaN [NaN] [195] 1 hSpCas9 negative selection 10328818
31184998 31185021 16 + 28162770 TF1 viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 NaN [NaN] [18] 1 hSpCas9 negative selection 10328819
31185037 31185060 16 + 28162770 TF1 viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 NaN [NaN] [270] 1 hSpCas9 negative selection 10328820
31185103 31185126 16 + 28162770 TF1 viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 NaN [NaN] [209] 1 hSpCas9 negative selection 10328821
31185130 31185153 16 + 28162770 TF1 viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 NaN [NaN] [63] 1 hSpCas9 negative selection 10328822
31190105 31190128 16 + 28162770 TF1 viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 NaN [NaN] [6] 1 hSpCas9 negative selection 10328823
31190328 31190351 16 + 28162770 TF1 viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 NaN [NaN] [124] 1 hSpCas9 negative selection 10328824
31191036 31191059 16 + 28162770 TF1 viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 NaN [NaN] [247] 1 hSpCas9 negative selection 10328825
31182401 31182424 16 + 28162770 TF1 viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 NaN [NaN] [130] 1 hSpCas9 negative selection 10328826
31184282 31184305 16 + 28162770 SKM1 viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 0.9149638961442007 [38] [129] 8 hSpCas9 negative selection 10498183
31183866 31183889 16 + 28162770 SKM1 viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.27356507332596325 [79] [116] -2 hSpCas9 negative selection 10498184
31184998 31185021 16 + 28162770 SKM1 viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 2.1039977205342177 [14] [113] 9 hSpCas9 negative selection 10498185
31185037 31185060 16 + 28162770 SKM1 viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 -0.13873712368904556 [103] [166] -1 hSpCas9 negative selection 10498186
31185103 31185126 16 + 28162770 SKM1 viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.5930358012568383 [50] [135] 6 hSpCas9 negative selection 10498187
31185130 31185153 16 + 28162770 SKM1 viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 0.17799830197799427 [17] [35] 1 hSpCas9 negative selection 10498188
31190105 31190128 16 + 28162770 SKM1 viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 -2.3019946391416193 [52] [18] -8 hSpCas9 negative selection 10498189
31190328 31190351 16 + 28162770 SKM1 viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 -0.7646685229560539 [73] [76] -5 hSpCas9 negative selection 10498190
31191036 31191059 16 + 28162770 SKM1 viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 -1.8891158938805424 [87] [41] -8 hSpCas9 negative selection 10498191
31182401 31182424 16 + 28162770 SKM1 viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.02553509210713778 [37] [65] 0 hSpCas9 negative selection 10498192
31184282 31184305 16 + 28162770 SKM1 viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 0.9149638961442007 [38] [129] 8 hSpCas9 negative selection 10667549
31183866 31183889 16 + 28162770 SKM1 viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.27356507332596325 [79] [116] -2 hSpCas9 negative selection 10667550
31184998 31185021 16 + 28162770 SKM1 viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 2.1039977205342177 [14] [113] 9 hSpCas9 negative selection 10667551
31185037 31185060 16 + 28162770 SKM1 viability TATGGACAGCAGGACCGTGGAGG FUS ENSG00000089280 -0.13873712368904556 [103] [166] -1 hSpCas9 negative selection 10667552
31185103 31185126 16 + 28162770 SKM1 viability GGTGGTTACAACCGCAGCAGTGG FUS ENSG00000089280 0.5930358012568383 [50] [135] 6 hSpCas9 negative selection 10667553
31185130 31185153 16 + 28162770 SKM1 viability TATGAACCCAGAGGTCGTGGAGG FUS ENSG00000089280 0.17799830197799427 [17] [35] 1 hSpCas9 negative selection 10667554
31190105 31190128 16 + 28162770 SKM1 viability GGTGGTGGCAATGGTCGTGGAGG FUS ENSG00000089280 -2.3019946391416193 [52] [18] -8 hSpCas9 negative selection 10667555
31190328 31190351 16 + 28162770 SKM1 viability GGAGGATTTCCCAGTGGAGGTGG FUS ENSG00000089280 -0.7646685229560539 [73] [76] -5 hSpCas9 negative selection 10667556
31191036 31191059 16 + 28162770 SKM1 viability GGACCGTGGAGGCTTCCGAGGGG FUS ENSG00000089280 -1.8891158938805424 [87] [41] -8 hSpCas9 negative selection 10667557
31182401 31182424 16 + 28162770 SKM1 viability ATACCCAACAAGCAACCCAAAGG FUS ENSG00000089280 -0.02553509210713778 [37] [65] 0 hSpCas9 negative selection 10667558
31184282 31184305 16 + 28162770 PL21 viability GGTGGACAGCAGCAAAGCTATGG FUS ENSG00000089280 -0.45436381948491306 [169] [53] -3 hSpCas9 negative selection 10836915
31183866 31183889 16 + 28162770 PL21 viability GGAACTCAGTCAACTCCCCAGGG FUS ENSG00000089280 -0.02542008592581091 [303] [129] 0 hSpCas9 negative selection 10836916
31184998 31185021 16 + 28162770 PL21 viability GGCAATCAAGACCAGAGTGGTGG FUS ENSG00000089280 -1.667756849503335 [72] [9] -8 hSpCas9 negative selection 10836917