Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 2395
  • Symbol: FXN
  • Description: frataxin
DataSource: http://genomecrispr.dkfz.de/#!/results/FXN

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
69035896 69035919 9 - 26472758 Jiyoye viability TGTCGGTGCGCAGGCCACGGCGG FXN ENSG00000165060 -1.3255407396589751 [225] [67] -7 hSpCas9 negative selection 60549
69046379 69046402 9 + 26472758 Jiyoye viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -1.2332822318069863 [52] [16] -7 hSpCas9 negative selection 60550
69053164 69053187 9 + 26472758 Jiyoye viability AAGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -1.9433218655782598 [50] [9] -8 hSpCas9 negative selection 60551
69035938 69035961 9 - 26472758 Jiyoye viability CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -1.499715214102645 [74] [19] -7 hSpCas9 negative selection 60552
69046393 69046416 9 - 26472758 Jiyoye viability AAATCTGGTTGAGGCCACGTTGG FXN ENSG00000165060 1.3754665217785353 [68] [134] 8 hSpCas9 negative selection 60553
69046474 69046497 9 - 26472758 Jiyoye viability GTGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -1.4211645656810667 [276] [77] -7 hSpCas9 negative selection 60554
69035839 69035862 9 + 26472758 Jiyoye viability CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -1.1179156632378842 [353] [122] -6 hSpCas9 negative selection 60555
69064944 69064967 9 + 26472758 Jiyoye viability GTCTTAACTGTCAAACTGGGTGG FXN ENSG00000165060 -2.0953249590233094 [33] [5] -8 hSpCas9 negative selection 60556
69035800 69035823 9 - 26472758 Jiyoye viability CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -1.4187952187190778 [77] [21] -7 hSpCas9 negative selection 60557
69035815 69035838 9 - 26472758 Jiyoye viability CTGGGCTGGGTGACGCCAGGAGG FXN ENSG00000165060 0.2551722880608236 [9] [8] 2 hSpCas9 negative selection 60558
69035896 69035919 9 - 26472758 KBM7 viability TGTCGGTGCGCAGGCCACGGCGG FXN ENSG00000165060 -0.718389866903065 [771,491] [169,183] -5 hSpCas9 negative selection 251667
69046379 69046402 9 + 26472758 KBM7 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.12388094867851951 [70,112] [67,30] 1 hSpCas9 negative selection 251668
69053164 69053187 9 + 26472758 KBM7 viability AAGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -1.281135583482359 [242,320] [100,14] -7 hSpCas9 negative selection 251669
69035938 69035961 9 - 26472758 KBM7 viability CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -1.6934013119237215 [328,100] [53,7] -8 hSpCas9 negative selection 251670
69046393 69046416 9 - 26472758 KBM7 viability AAATCTGGTTGAGGCCACGTTGG FXN ENSG00000165060 -0.04395908345440852 [634,458] [329,171] 0 hSpCas9 negative selection 251671
69046474 69046497 9 - 26472758 KBM7 viability GTGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.0722911987801244 [453,434] [249,153] 0 hSpCas9 negative selection 251672
69035839 69035862 9 + 26472758 KBM7 viability CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -0.3924442885604782 [1339,1186] [555,358] -4 hSpCas9 negative selection 251673
69064944 69064967 9 + 26472758 KBM7 viability GTCTTAACTGTCAAACTGGGTGG FXN ENSG00000165060 -0.3285098329287064 [86,107] [25,46] -3 hSpCas9 negative selection 251674
69035800 69035823 9 - 26472758 KBM7 viability CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -1.9950827195169465 [498,215] [46,34] -8 hSpCas9 negative selection 251675
69035815 69035838 9 - 26472758 KBM7 viability CTGGGCTGGGTGACGCCAGGAGG FXN ENSG00000165060 -4.3100194349086145 [101,64] [2,0] -9 hSpCas9 negative selection 251676
69035896 69035919 9 - 26472758 Raji viability TGTCGGTGCGCAGGCCACGGCGG FXN ENSG00000165060 -0.008093682046336426 [285] [65] 0 hSpCas9 negative selection 442785
69046379 69046402 9 + 26472758 Raji viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 1.5509901868492142 [24] [16] 9 hSpCas9 negative selection 442786
69053164 69053187 9 + 26472758 Raji viability AAGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 0.5385407000157201 [88] [29] 5 hSpCas9 negative selection 442787
69035938 69035961 9 - 26472758 Raji viability CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.11500888596284842 [111] [23] -1 hSpCas9 negative selection 442788
69046393 69046416 9 - 26472758 Raji viability AAATCTGGTTGAGGCCACGTTGG FXN ENSG00000165060 1.4423677830864081 [175] [110] 9 hSpCas9 negative selection 442789
69046474 69046497 9 - 26472758 Raji viability GTGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.30765396390524435 [239] [44] -3 hSpCas9 negative selection 442790
69035839 69035862 9 + 26472758 Raji viability CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 0.0040957269615773395 [549] [127] 0 hSpCas9 negative selection 442791
69064944 69064967 9 + 26472758 Raji viability GTCTTAACTGTCAAACTGGGTGG FXN ENSG00000165060 -1.5930561827674925 [77] [5] -8 hSpCas9 negative selection 442792
69035800 69035823 9 - 26472758 Raji viability CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -0.12708171826342352 [159] [33] -1 hSpCas9 negative selection 442793
69035815 69035838 9 - 26472758 Raji viability CTGGGCTGGGTGACGCCAGGAGG FXN ENSG00000165060 -0.647503966789869 [26] [3] -5 hSpCas9 negative selection 442794
69035896 69035919 9 - 26472758 K562 viability TGTCGGTGCGCAGGCCACGGCGG FXN ENSG00000165060 -0.05931225953657551 [452] [366] 0 hSpCas9 negative selection 633903
69046379 69046402 9 + 26472758 K562 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.27578289857578175 [90] [92] 2 hSpCas9 negative selection 633904
69053164 69053187 9 + 26472758 K562 viability AAGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -1.860697978147767 [184] [42] -7 hSpCas9 negative selection 633905
69035938 69035961 9 - 26472758 K562 viability CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -2.3757332015170096 [165] [26] -8 hSpCas9 negative selection 633906
69046393 69046416 9 - 26472758 K562 viability AAATCTGGTTGAGGCCACGTTGG FXN ENSG00000165060 0.3253928061990107 [484] [512] 2 hSpCas9 negative selection 633907
69046474 69046497 9 - 26472758 K562 viability GTGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.21063445046027593 [328] [239] -1 hSpCas9 negative selection 633908
69035839 69035862 9 + 26472758 K562 viability CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -0.6427086131206418 [724] [391] -4 hSpCas9 negative selection 633909
69064944 69064967 9 + 26472758 K562 viability GTCTTAACTGTCAAACTGGGTGG FXN ENSG00000165060 -5.147898695112312 [41] [0] -9 hSpCas9 negative selection 633910
69035800 69035823 9 - 26472758 K562 viability CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -2.8739759731357832 [329] [37] -8 hSpCas9 negative selection 633911
69035815 69035838 9 - 26472758 K562 viability CTGGGCTGGGTGACGCCAGGAGG FXN ENSG00000165060 -2.577582970355558 [98] [13] -8 hSpCas9 negative selection 633912
69035937 69035960 9 - 26627737 DLD1 viability GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.3937223368597267 [139] [52,0,42] -4 hSpCas9 negative selection 843179
69035938 69035961 9 - 26627737 DLD1 viability CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -4.457816032141929 [118] [1,0,1] -9 hSpCas9 negative selection 843180
69046379 69046402 9 + 26627737 DLD1 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.41879727880845485 [449] [118,78,114] -4 hSpCas9 negative selection 843181
69072616 69072639 9 + 26627737 DLD1 viability CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.08833010039413319 [341] [72,156,112] 0 hSpCas9 negative selection 843182
69099888 69099911 9 + 26627737 DLD1 viability CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.7967645422999621 [257] [156,194,79] 7 hSpCas9 negative selection 843183
69035937 69035960 9 - 26627737 GBM cells viability after 5 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 0.07948612052750592 [14] [8,7] 1 hSpCas9 negative selection 925494
69035938 69035961 9 - 26627737 GBM cells viability after 5 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.7659019335246853 [64] [12,27] -8 hSpCas9 negative selection 925495
69046379 69046402 9 + 26627737 GBM cells viability after 5 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.1465730548325635 [282] [187,147] 2 hSpCas9 negative selection 925496
69072616 69072639 9 + 26627737 GBM cells viability after 5 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.3190223637119513 [212] [163,120] 5 hSpCas9 negative selection 925497
69099888 69099911 9 + 26627737 GBM cells viability after 5 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.857334771134286 [175] [169,171] 9 hSpCas9 negative selection 925498
69035937 69035960 9 - 26627737 GBM cells viability after 13 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.2825275781943528 [14] [4,1] -8 hSpCas9 negative selection 1007809
69035938 69035961 9 - 26627737 GBM cells viability after 13 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -3.177878981249785 [64] [4,2] -9 hSpCas9 negative selection 1007810
69046379 69046402 9 + 26627737 GBM cells viability after 13 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.18017123240010746 [282] [145,126] -2 hSpCas9 negative selection 1007811
69072616 69072639 9 + 26627737 GBM cells viability after 13 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.1964412228959082 [212] [159,109] 2 hSpCas9 negative selection 1007812
69099888 69099911 9 + 26627737 GBM cells viability after 13 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.9957617318280532 [175] [217,167] 9 hSpCas9 negative selection 1007813
69035937 69035960 9 - 26627737 GBM cells viability after 21 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -3.0266572959928606 [14] [0,0] -9 hSpCas9 negative selection 1090124
69035938 69035961 9 - 26627737 GBM cells viability after 21 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -1.6213630708774114 [64] [11,10] -8 hSpCas9 negative selection 1090125
69046379 69046402 9 + 26627737 GBM cells viability after 21 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.379745626697864 [282] [125,110] -3 hSpCas9 negative selection 1090126
69072616 69072639 9 + 26627737 GBM cells viability after 21 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 -0.30005801034073076 [212] [105,82] -3 hSpCas9 negative selection 1090127
69099888 69099911 9 + 26627737 GBM cells viability after 21 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.9301808298930494 [175] [200,164] 8 hSpCas9 negative selection 1090128
69035937 69035960 9 - 26627737 RPE1 viability after 9 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 0.3609670785881476 [116] [67,19] 2 hSpCas9 negative selection 1172439
69035938 69035961 9 - 26627737 RPE1 viability after 9 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -2.474300589189862 [133] [0,15] -9 hSpCas9 negative selection 1172440
69046379 69046402 9 + 26627737 RPE1 viability after 9 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.20109938278574413 [303] [94,127] 1 hSpCas9 negative selection 1172441
69072616 69072639 9 + 26627737 RPE1 viability after 9 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.04713474152028768 [855] [282,268] 0 hSpCas9 negative selection 1172442
69099888 69099911 9 + 26627737 RPE1 viability after 9 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.7090745955940999 [862] [249,688] 5 hSpCas9 negative selection 1172443
69035937 69035960 9 - 26627737 RPE1 viability after 12 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.9137117659752159 [116] [2,13] -8 hSpCas9 negative selection 1254754
69035938 69035961 9 - 26627737 RPE1 viability after 12 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -5.169977778784634 [133] [0,0] -9 hSpCas9 negative selection 1254755
69046379 69046402 9 + 26627737 RPE1 viability after 12 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.5189260876057062 [303] [73,38] -4 hSpCas9 negative selection 1254756
69072616 69072639 9 + 26627737 RPE1 viability after 12 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 -0.09065891786422886 [855] [231,198] 0 hSpCas9 negative selection 1254757
69099888 69099911 9 + 26627737 RPE1 viability after 12 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.44745785399204085 [862] [304,327] 3 hSpCas9 negative selection 1254758
69035937 69035960 9 - 26627737 RPE1 viability after 15 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.24967861714111494 [116] [36,18] -1 hSpCas9 negative selection 1337069
69035938 69035961 9 - 26627737 RPE1 viability after 15 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -5.244340316585879 [133] [0,0] -9 hSpCas9 negative selection 1337070
69046379 69046402 9 + 26627737 RPE1 viability after 15 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -1.7552901233549905 [303] [26,23] -8 hSpCas9 negative selection 1337071
69072616 69072639 9 + 26627737 RPE1 viability after 15 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.033293189406662815 [855] [202,290] 0 hSpCas9 negative selection 1337072
69099888 69099911 9 + 26627737 RPE1 viability after 15 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.6509764166599644 [862] [420,346] 4 hSpCas9 negative selection 1337073
69035937 69035960 9 - 26627737 RPE1 viability after 18 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 0.517070261879828 [116] [35,54] 3 hSpCas9 negative selection 1419384
69035938 69035961 9 - 26627737 RPE1 viability after 18 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -4.607501272131596 [133] [0,1] -9 hSpCas9 negative selection 1419385
69046379 69046402 9 + 26627737 RPE1 viability after 18 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.4958055115835436 [303] [77,36] -3 hSpCas9 negative selection 1419386
69072616 69072639 9 + 26627737 RPE1 viability after 18 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 -0.19925106294211292 [855] [148,256] -1 hSpCas9 negative selection 1419387
69099888 69099911 9 + 26627737 RPE1 viability after 18 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.8292116033184942 [862] [465,357] 5 hSpCas9 negative selection 1419388
69035937 69035960 9 - 26627737 HeLa viability after 8 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.2889743564514338 [387] [52,129,23] -8 hSpCas9 negative selection 1501699
69035938 69035961 9 - 26627737 HeLa viability after 8 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 0.1689981246445913 [96] [25,113,0] 1 hSpCas9 negative selection 1501700
69046379 69046402 9 + 26627737 HeLa viability after 8 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.7326124465558108 [226] [306,69,147] 6 hSpCas9 negative selection 1501701
69072616 69072639 9 + 26627737 HeLa viability after 8 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.18564564992186283 [193] [151,61,86] 1 hSpCas9 negative selection 1501702
69099888 69099911 9 + 26627737 HeLa viability after 8 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 -0.48823787223950654 [487] [162,131,160] -5 hSpCas9 negative selection 1501703
69035937 69035960 9 - 26627737 HeLa viability after 12 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.6243244370739423 [387] [1,170,128] -5 hSpCas9 negative selection 1584014
69035938 69035961 9 - 26627737 HeLa viability after 12 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 0.14574253578747776 [96] [13,26,92] 1 hSpCas9 negative selection 1584015
69046379 69046402 9 + 26627737 HeLa viability after 12 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.8067908710800332 [226] [191,136,166] 6 hSpCas9 negative selection 1584016
69072616 69072639 9 + 26627737 HeLa viability after 12 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.830835362981169 [193] [114,104,210] 6 hSpCas9 negative selection 1584017
69099888 69099911 9 + 26627737 HeLa viability after 12 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 -0.22727142184467203 [487] [84,193,232] -2 hSpCas9 negative selection 1584018
69035937 69035960 9 - 26627737 HeLa viability after 15 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.244299597940713 [387] [112,36,47] -8 hSpCas9 negative selection 1666329
69035938 69035961 9 - 26627737 HeLa viability after 15 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.17546647491994438 [96] [0,0,108] -1 hSpCas9 negative selection 1666330
69046379 69046402 9 + 26627737 HeLa viability after 15 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.5477301252558879 [226] [126,195,77] 4 hSpCas9 negative selection 1666331
69072616 69072639 9 + 26627737 HeLa viability after 15 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 1.0742923778605358 [193] [203,96,199] 7 hSpCas9 negative selection 1666332
69099888 69099911 9 + 26627737 HeLa viability after 15 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 -0.31165571846409074 [487] [73,238,168] -3 hSpCas9 negative selection 1666333
69035937 69035960 9 - 26627737 HeLa viability after 18 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.2368537155359163 [387] [76,29,47] -8 hSpCas9 negative selection 1748644
69035938 69035961 9 - 26627737 HeLa viability after 18 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.16560287548278518 [96] [0,0,108] -1 hSpCas9 negative selection 1748645
69046379 69046402 9 + 26627737 HeLa viability after 18 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.5386572653779669 [226] [78,167,77] 4 hSpCas9 negative selection 1748646
69072616 69072639 9 + 26627737 HeLa viability after 18 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 1.0683387144491823 [193] [134,80,199] 7 hSpCas9 negative selection 1748647
69099888 69099911 9 + 26627737 HeLa viability after 18 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 -0.2912741226678054 [487] [49,202,168] -3 hSpCas9 negative selection 1748648
69035937 69035960 9 - 26627737 HCT116 viability after 6 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.8503092699123895 [601] [13,32] -8 hSpCas9 negative selection 1830959
69035938 69035961 9 - 26627737 HCT116 viability after 6 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -1.4648740778873142 [239] [3,18] -7 hSpCas9 negative selection 1830960
69046379 69046402 9 + 26627737 HCT116 viability after 6 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.6795845949719712 [530] [142,1] -4 hSpCas9 negative selection 1830961
69072616 69072639 9 + 26627737 HCT116 viability after 6 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 -0.09261048135074973 [516] [208,2] 0 hSpCas9 negative selection 1830962
69099888 69099911 9 + 26627737 HCT116 viability after 6 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.28073280428429814 [735] [117,152] 1 hSpCas9 negative selection 1830963
69035937 69035960 9 - 26627737 HCT116 viability after 8 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.01823544161535473 [148] [91,118,32] 0 hSpCas9 negative selection 1913274
69035938 69035961 9 - 26627737 HCT116 viability after 8 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 0.3916910213058027 [40] [28,37,21] 4 hSpCas9 negative selection 1913275
69046379 69046402 9 + 26627737 HCT116 viability after 8 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.007781586959894546 [285] [155,138,174] 0 hSpCas9 negative selection 1913276
69072616 69072639 9 + 26627737 HCT116 viability after 8 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.5149924383192841 [133] [85,108,120] 5 hSpCas9 negative selection 1913277
69099888 69099911 9 + 26627737 HCT116 viability after 8 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.964706910630255 [225] [308,234,186] 8 hSpCas9 negative selection 1913278
69035937 69035960 9 - 26627737 HCT116 viability after 9 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.094621618807789 [601] [24,114] -6 hSpCas9 negative selection 1995589
69035938 69035961 9 - 26627737 HCT116 viability after 9 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 0.6773890990142591 [239] [73,124] 5 hSpCas9 negative selection 1995590
69046379 69046402 9 + 26627737 HCT116 viability after 9 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.41280760054989996 [530] [53,147] -3 hSpCas9 negative selection 1995591
69072616 69072639 9 + 26627737 HCT116 viability after 9 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 -0.8686475627343044 [516] [45,98] -6 hSpCas9 negative selection 1995592
69099888 69099911 9 + 26627737 HCT116 viability after 9 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.5886400896029617 [735] [132,423] 4 hSpCas9 negative selection 1995593
69035937 69035960 9 - 26627737 HCT116 viability after 12 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.2901901099285555 [148] [13,46,36] -8 hSpCas9 negative selection 2077904
69035938 69035961 9 - 26627737 HCT116 viability after 12 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.551918302686444 [40] [24,6,10] -5 hSpCas9 negative selection 2077905
69046379 69046402 9 + 26627737 HCT116 viability after 12 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.05924895474651318 [285] [161,135,132] 0 hSpCas9 negative selection 2077906
69072616 69072639 9 + 26627737 HCT116 viability after 12 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 1.2144141675458222 [133] [171,143,172] 8 hSpCas9 negative selection 2077907
69099888 69099911 9 + 26627737 HCT116 viability after 12 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.4507825082230591 [225] [174,125,183] 4 hSpCas9 negative selection 2077908
69035937 69035960 9 - 26627737 HCT116 viability after 15 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.5955558962046437 [148] [62,78,28] -6 hSpCas9 negative selection 2160219
69035938 69035961 9 - 26627737 HCT116 viability after 15 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -2.392332645924084 [40] [0,4,6] -9 hSpCas9 negative selection 2160220
69046379 69046402 9 + 26627737 HCT116 viability after 15 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.15635959897470014 [285] [124,132,180] -2 hSpCas9 negative selection 2160221
69072616 69072639 9 + 26627737 HCT116 viability after 15 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 1.171880535132838 [133] [228,130,166] 8 hSpCas9 negative selection 2160222
69099888 69099911 9 + 26627737 HCT116 viability after 15 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 1.0735410166222852 [225] [322,184,316] 8 hSpCas9 negative selection 2160223
69035937 69035960 9 - 26627737 HCT116 viability after 18 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.25901133804003496 [148] [10,93,73] -2 hSpCas9 negative selection 2242534
69035938 69035961 9 - 26627737 HCT116 viability after 18 days CGCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -2.861407710437096 [40] [0,4,1] -9 hSpCas9 negative selection 2242535
69046379 69046402 9 + 26627737 HCT116 viability after 18 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.14870011088006657 [285] [168,153,135] 1 hSpCas9 negative selection 2242536
69072616 69072639 9 + 26627737 HCT116 viability after 18 days CCTAAGCGTTATGACTGGACTGG FXN ENSG00000165060 0.8272667655464367 [133] [67,89,191] 6 hSpCas9 negative selection 2242537
69099888 69099911 9 + 26627737 HCT116 viability after 18 days CTTCTCCTGGAAGGTTAACGTGG FXN ENSG00000165060 0.5198835371220831 [225] [169,73,234] 4 hSpCas9 negative selection 2242538
69035449 69035472 9 - 25494202 A375 resistance to PLX-4720 (puromycin) GGCTGCTTGGCCGCCGGTATGGG FXN ENSG00000165060 1.4537016414350028 [202,137] [191,5] 5 dCas9-VP64 positive selection 2403755
69035427 69035450 9 - 25494202 A375 resistance to PLX-4720 (puromycin) GTTTACAGCAGTTGGGTATGTGG FXN ENSG00000165060 -1.4929167073071683 [32,106] [5,3] -8 dCas9-VP64 positive selection 2403756
69035402 69035425 9 + 25494202 A375 resistance to PLX-4720 (puromycin) TACACAAGGCATCCGTCTCCTGG FXN ENSG00000165060 -0.48393123597235754 [445,241] [61,43] -2 dCas9-VP64 positive selection 2403757
69040071 69040094 9 + 25494202 A375 resistance to PLX-4720 (puromycin) ACCTCTCAATACTGCCACATCGG FXN ENSG00000165060 1.1379885520455113 [361,151] [180,60] 4 dCas9-VP64 positive selection 2475893
69035449 69035472 9 - 25494202 A375 resistance to PLX-4720 (zeocin) GGCTGCTTGGCCGCCGGTATGGG FXN ENSG00000165060 0.29801679081822274 [61,8] [23,4] 2 dCas9-VP64 positive selection 2499010
69035427 69035450 9 - 25494202 A375 resistance to PLX-4720 (zeocin) GTTTACAGCAGTTGGGTATGTGG FXN ENSG00000165060 -0.49205712051770945 [102,182] [37,27] -5 dCas9-VP64 positive selection 2499011
69035402 69035425 9 + 25494202 A375 resistance to PLX-4720 (zeocin) TACACAAGGCATCCGTCTCCTGG FXN ENSG00000165060 1.5699256352135191 [141,379] [114,378] 8 dCas9-VP64 positive selection 2499012
69040071 69040094 9 + 25494202 A375 resistance to PLX-4720 (zeocin) ACCTCTCAATACTGCCACATCGG FXN ENSG00000165060 2.187800746540209 [198,312] [652,123] 8 dCas9-VP64 positive selection 2571148
69035848 69035871 9 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity AGACCCTCACCCGGGTCCCGCGG FXN ENSG00000165060 0.5033842927195451 [1,1] [2,2] 8 hSpCas9 positive selection 2989550
69035800 69035823 9 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 0.5224057234398887 [1,2] [2,3] 9 hSpCas9 positive selection 2989551
69035840 69035863 9 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -0.9363073976556111 [1,1] [0,0] -9 hSpCas9 positive selection 2989552
69035941 69035964 9 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CGGCGCGGATACTTACTGCGCGG FXN ENSG00000165060 -0.6128750959628733 [2,3] [2,0] -7 hSpCas9 positive selection 2989553
69035848 69035871 9 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity AGACCCTCACCCGGGTCCCGCGG FXN ENSG00000165060 -0.7121374316332504 [1,1] [0,0] -8 hSpCas9 positive selection 3057408
69035800 69035823 9 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -0.3975370767206732 [1,1] [0,0] -6 hSpCas9 positive selection 3057409
69035840 69035863 9 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -0.6508211540795044 [1,1] [0,0] -8 hSpCas9 positive selection 3057410
69035941 69035964 9 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CGGCGCGGATACTTACTGCGCGG FXN ENSG00000165060 -0.9591489149190048 [2,2] [0,0] -9 hSpCas9 positive selection 3057411
69035913 69035936 - 24336571 A375 resistance to PLX after 7 days CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 0.19569518498421656 [29,25] [32,30] 6 hSpCas9 positive selection 3115553
69035937 69035960 - 24336571 A375 resistance to PLX after 7 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 0.3767300739674432 [12,12] [15,17] 8 hSpCas9 positive selection 3115554
69046379 69046402 + 24336571 A375 resistance to PLX after 7 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.31575533932425986 [13,14] [16,18] 8 hSpCas9 positive selection 3115555
69035913 69035936 - 24336571 A375 resistance to PLX after 14 days CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.061033404388886714 [41,33] [16,15] 0 hSpCas9 positive selection 3173346
69035937 69035960 - 24336571 A375 resistance to PLX after 14 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 0.8291975423638862 [6,8] [7,5] 7 hSpCas9 positive selection 3173347
69046379 69046402 + 24336571 A375 resistance to PLX after 14 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 1.7720159987670012 [8,7] [16,10] 9 hSpCas9 positive selection 3173348
69035913 69035936 - 24336571 A375 viability after 7 days CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.35602851555488235 [37] [29,25] -5 hSpCas9 negative selection 3231139
69035937 69035960 - 24336571 A375 viability after 7 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.1152573109533594 [29] [12,12] -9 hSpCas9 negative selection 3231140
69046379 69046402 + 24336571 A375 viability after 7 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.6459301166344165 [24] [13,14] -7 hSpCas9 negative selection 3231141
69035913 69035936 - 24336571 A375 viability after 14 days CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 0.07377500649069502 [37] [41,33] 0 hSpCas9 negative selection 3288932
69035937 69035960 - 24336571 A375 viability after 14 days GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -1.7255261299664904 [29] [6,8] -9 hSpCas9 negative selection 3288933
69046379 69046402 + 24336571 A375 viability after 14 days TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -1.352470226269512 [24] [8,7] -9 hSpCas9 negative selection 3288934
69035936 69035959 9 - 27383988 293T resistance to West Nile virus (flavivirus) CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 2.7366369246031286 [15,29] [0,0] 8 hSpCas9 positive selection 3350723
69035913 69035936 9 - 27383988 293T resistance to West Nile virus (flavivirus) CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 1.70414241939734 [39,53] [0,0] 7 hSpCas9 positive selection 3350724
69046379 69046402 9 + 27383988 293T resistance to West Nile virus (flavivirus) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.23873508916286443 [153,104] [0,0] 1 hSpCas9 positive selection 3350725
69064978 69065001 9 - 27383988 293T resistance to West Nile virus (flavivirus) CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -1.4465773619988285 [416,416] [0,0] -8 hSpCas9 positive selection 3369933
69053155 69053178 9 + 27383988 293T resistance to West Nile virus (flavivirus) CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 0.38696149186243056 [116,116] [0,0] 2 hSpCas9 positive selection 3369934
69064940 69064963 9 + 27383988 293T resistance to West Nile virus (flavivirus) TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 1.1008217257658441 [213,213] [2,2] 5 hSpCas9 positive selection 3369935
69035847 69035870 9 + 26780180 HT29 viability (Avana library 4 designs) AGACCCTCACCCGGGTCCCGCGG FXN ENSG00000165060 1.14547969735576 [] [] 4 hSpCas9 negative selection 3426501
69035800 69035823 9 - 26780180 HT29 viability (Avana library 4 designs) CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 2.61529300291667 [] [] 8 hSpCas9 negative selection 3426502
69035839 69035862 9 + 26780180 HT29 viability (Avana library 4 designs) CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 1.42575985993168 [] [] 5 hSpCas9 negative selection 3426503
69035941 69035964 9 - 26780180 HT29 viability (Avana library 4 designs) CGGCGCGGATACTTACTGCGCGG FXN ENSG00000165060 4.67534221623341 [] [] 9 hSpCas9 negative selection 3426504
69035800 69035823 9 - 26780180 A375 viability (Avana lentiCRISPRv2) CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -8.691755216069 [] [] -7 hSpCas9 negative selection 3509194
69035941 69035964 9 - 26780180 A375 viability (Avana lentiCRISPRv2) CGGCGCGGATACTTACTGCGCGG FXN ENSG00000165060 -13.2030613924237 [] [] -8 hSpCas9 negative selection 3509195
69035847 69035870 9 + 26780180 A375 viability (Avana lentiCRISPRv2) AGACCCTCACCCGGGTCCCGCGG FXN ENSG00000165060 5.76406498177535 [] [] 9 hSpCas9 negative selection 3509196
69035839 69035862 9 + 26780180 A375 viability (Avana lentiCRISPRv2) CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -3.60718445119135 [] [] -4 hSpCas9 negative selection 3509197
69046379 69046402 9 + 26780180 A375 viability (Avana lentiCRISPRv2) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.770472304794708 [] [] 1 hSpCas9 negative selection 3509198
69035873 69035896 9 + 26780180 A375 viability (Avana lentiCRISPRv2) GCAGAGTTGGCCCCACTCTGCGG FXN ENSG00000165060 2.84211366342954 [] [] 4 hSpCas9 negative selection 3509199
69035800 69035823 9 - 26780180 A375 viability (Avana lentiGuide) CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 6.95336880043888 [] [] 5 hSpCas9 negative selection 3617853
69035941 69035964 9 - 26780180 A375 viability (Avana lentiGuide) CGGCGCGGATACTTACTGCGCGG FXN ENSG00000165060 24.8629578398241 [] [] 9 hSpCas9 negative selection 3617854
69035847 69035870 9 + 26780180 A375 viability (Avana lentiGuide) AGACCCTCACCCGGGTCCCGCGG FXN ENSG00000165060 1.10585245211541 [] [] 1 hSpCas9 negative selection 3617855
69035839 69035862 9 + 26780180 A375 viability (Avana lentiGuide) CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 13.915700821967 [] [] 7 hSpCas9 negative selection 3617856
69046379 69046402 9 + 26780180 A375 viability (Avana lentiGuide) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 13.6735298622511 [] [] 7 hSpCas9 negative selection 3617857
69035873 69035896 9 + 26780180 A375 viability (Avana lentiGuide) GCAGAGTTGGCCCCACTCTGCGG FXN ENSG00000165060 -1.52625296057285 [] [] -2 hSpCas9 negative selection 3617858
69035800 69035823 9 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -0.9252472278978521 [4] [1,1] -8 hSpCas9 positive selection 3726512
69035941 69035964 9 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CGGCGCGGATACTTACTGCGCGG FXN ENSG00000165060 -1.1393390669249734 [4] [2,0] -9 hSpCas9 positive selection 3726513
69035847 69035870 9 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AGACCCTCACCCGGGTCCCGCGG FXN ENSG00000165060 0.4964210812568038 [3] [4,4] 9 hSpCas9 positive selection 3726514
69035839 69035862 9 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -0.33629937645502656 [4] [3,2] -5 hSpCas9 positive selection 3726515
69046379 69046402 9 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.16975659473369073 [4] [5,4] 4 hSpCas9 positive selection 3726516
69035873 69035896 9 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCAGAGTTGGCCCCACTCTGCGG FXN ENSG00000165060 0.16731952498676342 [4] [5,4] 4 hSpCas9 positive selection 3726517
69035800 69035823 9 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CCAGGAGGCCGGCTACTGCGCGG FXN ENSG00000165060 -0.9150914730628715 [4] [0,3] -8 hSpCas9 positive selection 3835119
69035941 69035964 9 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CGGCGCGGATACTTACTGCGCGG FXN ENSG00000165060 -1.4690921615595955 [5] [1,0] -9 hSpCas9 positive selection 3835120
69035847 69035870 9 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AGACCCTCACCCGGGTCCCGCGG FXN ENSG00000165060 0.11310508101046943 [4] [3,3] 2 hSpCas9 positive selection 3835121
69035839 69035862 9 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CCAGGCCCAGACCCTCACCCGGG FXN ENSG00000165060 -1.4143563622571864 [2] [0,0] -9 hSpCas9 positive selection 3835122
69046379 69046402 9 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.2479628929465356 [4] [1,4] -3 hSpCas9 positive selection 3835123
69035873 69035896 9 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCAGAGTTGGCCCCACTCTGCGG FXN ENSG00000165060 0.06529003154297577 [4] [4,3] 1 hSpCas9 positive selection 3835124
69053155 69053178 9 + 26780180 A375 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 1.87273989547664 [] [] 9 hSpCas9 negative selection 3942293
69035936 69035959 9 - 26780180 A375 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 0.958777976452261 [] [] 4 hSpCas9 negative selection 3942294
69064978 69065001 9 - 26780180 A375 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 1.76434695835582 [] [] 9 hSpCas9 negative selection 3942295
69035913 69035936 9 - 26780180 A375 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 1.55806272645914 [] [] 8 hSpCas9 negative selection 3942296
69064940 69064963 9 + 26780180 A375 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.970184656902092 [] [] 4 hSpCas9 negative selection 3942297
69046379 69046402 9 + 26780180 A375 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 1.76015662207526 [] [] 9 hSpCas9 negative selection 3942298
69053155 69053178 9 + 26780180 HT29 viability (GeCKOv2 library) CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 1.9758407029854 [] [] 9 hSpCas9 negative selection 4050259
69035936 69035959 9 - 26780180 HT29 viability (GeCKOv2 library) CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 1.66393560408757 [] [] 8 hSpCas9 negative selection 4050260
69064978 69065001 9 - 26780180 HT29 viability (GeCKOv2 library) CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 1.53857149490104 [] [] 7 hSpCas9 negative selection 4050261
69035913 69035936 9 - 26780180 HT29 viability (GeCKOv2 library) CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 2.46240210170948 [] [] 9 hSpCas9 negative selection 4050262
69064940 69064963 9 + 26780180 HT29 viability (GeCKOv2 library) TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 1.00101152599769 [] [] 4 hSpCas9 negative selection 4050263
69046379 69046402 9 + 26780180 HT29 viability (GeCKOv2 library) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 1.30547052958151 [] [] 6 hSpCas9 negative selection 4050264
69035913 69035936 9 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 0.046051702534453565 [5] [2,3] 1 hSpCas9 positive selection 4138669
69035937 69035960 9 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.25539686510447884 [4] [1,2] -6 hSpCas9 positive selection 4138670
69046379 69046402 9 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.14105637511352598 [4] [2,3] 3 hSpCas9 positive selection 4138671
69035913 69035936 9 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 0.17270464675743163 [5] [2,1,1,2] 1 hSpCas9 positive selection 4202691
69035937 69035960 9 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) GCGGATACTTACTGCGCGGCGGG FXN ENSG00000165060 -0.7497985281760957 [4] [2,0,0,0] -9 hSpCas9 positive selection 4202692
69046379 69046402 9 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.6568337935692444 [5] [2,0,1,0] -8 hSpCas9 positive selection 4202693
69035936 69035959 9 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -0.4893034711936439 [1] [0,0] -8 hSpCas9 positive selection 4271903
69035913 69035936 9 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.7840019021003439 [2] [1,0] -9 hSpCas9 positive selection 4271904
69046379 69046402 9 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.04277385036191851 [2] [3,1] -1 hSpCas9 positive selection 4271905
69037308 69037331 9 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.059408178841951154 [1] [1,0] -1 hSpCas9 positive selection 4311112
69064978 69065001 9 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 0.18721235886742615 [3] [3,3] 4 hSpCas9 positive selection 4336164
69053155 69053178 9 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -0.29154273081669246 [2] [2,0] -6 hSpCas9 positive selection 4336165
69064940 69064963 9 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.004418524754964431 [2] [3,1] 0 hSpCas9 positive selection 4336166
69035905 69035927 9 - 27760321 OCIAML3 viability CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 0.7410408446843901 [217,247] [337,266] 8 hSpCas9 negative selection 4402361
69035938 69035960 9 - 27760321 OCIAML3 viability GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.9219779381107396 [1019,847] [336,444] -7 hSpCas9 negative selection 4402362
69046380 69046402 9 + 27760321 OCIAML3 viability TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.9270821348182277 [286,234] [52,176] -7 hSpCas9 negative selection 4402363
69046474 69046496 9 - 27760321 OCIAML3 viability TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.4527742105477299 [291,244] [98,222] -4 hSpCas9 negative selection 4402364
69053165 69053187 9 + 27760321 OCIAML3 viability AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -0.05106437611955783 [276,257] [178,231] 0 hSpCas9 negative selection 4402365
69035905 69035927 9 - 27760321 OCIAML2 viability CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 0.39634035387138133 [217,247] [219,289] 5 hSpCas9 negative selection 4485824
69035938 69035960 9 - 27760321 OCIAML2 viability GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 0.15501905483284495 [1019,847] [841,831] 2 hSpCas9 negative selection 4485825
69046380 69046402 9 + 27760321 OCIAML2 viability TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.7322886592974565 [286,234] [119,134] -6 hSpCas9 negative selection 4485826
69046474 69046496 9 - 27760321 OCIAML2 viability TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.17879135395171208 [291,244] [128,272] -2 hSpCas9 negative selection 4485827
69053165 69053187 9 + 27760321 OCIAML2 viability AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -0.2799531385101276 [276,257] [176,179] -3 hSpCas9 negative selection 4485828
69035905 69035927 9 - 27760321 MV411 viability CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 1.0484196987144916 [217,247] [241,438] 7 hSpCas9 negative selection 4569287
69035938 69035960 9 - 27760321 MV411 viability GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.49444934559016507 [1019,847] [475,374] -3 hSpCas9 negative selection 4569288
69046380 69046402 9 + 27760321 MV411 viability TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.8865844396566991 [286,234] [397,194] 6 hSpCas9 negative selection 4569289
69046474 69046496 9 - 27760321 MV411 viability TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.9784833179197896 [291,244] [55,139] -6 hSpCas9 negative selection 4569290
69053165 69053187 9 + 27760321 MV411 viability AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -0.6426939099371086 [276,257] [1,279] -4 hSpCas9 negative selection 4569291
69035905 69035927 9 - 27760321 HL60 viability CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 0.13283177508998523 [217,247] [159,263] 1 hSpCas9 negative selection 4652750
69035938 69035960 9 - 27760321 HL60 viability GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 0.08376432353429575 [1019,847] [692,923] 1 hSpCas9 negative selection 4652751
69046380 69046402 9 + 27760321 HL60 viability TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 1.1592511445796863 [286,234] [418,531] 9 hSpCas9 negative selection 4652752
69046474 69046496 9 - 27760321 HL60 viability TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 0.34127689943609824 [291,244] [252,301] 4 hSpCas9 negative selection 4652753
69053165 69053187 9 + 27760321 HL60 viability AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 0.14364828360951154 [276,257] [273,206] 1 hSpCas9 negative selection 4652754
69035905 69035927 9 - 27760321 HT1080 viability CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 0.9952227837439114 [247,193] [175,174] 5 hSpCas9 negative selection 4736213
69035938 69035960 9 - 27760321 HT1080 viability GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -2.758783059285304 [847,661] [0,91] -7 hSpCas9 negative selection 4736214
69046380 69046402 9 + 27760321 HT1080 viability TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -3.853825756739279 [234,183] [0,10] -8 hSpCas9 negative selection 4736215
69046474 69046496 9 - 27760321 HT1080 viability TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -1.1597715169387222 [244,190] [14,64] -4 hSpCas9 negative selection 4736216
69053165 69053187 9 + 27760321 HT1080 viability AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -5.911374028849804 [257,201] [1,0] -9 hSpCas9 negative selection 4736217
69035905 69035927 9 - 27760321 HT29 viability after 7 days CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -1.0354617283496956 [247,193] [150,175,91] -8 hSpCas9 negative selection 4819676
69035938 69035960 9 - 27760321 HT29 viability after 7 days GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.22055086454650097 [847,661] [758,781,942] -3 hSpCas9 negative selection 4819677
69046380 69046402 9 + 27760321 HT29 viability after 7 days TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.39284750164337057 [234,183] [339,168,127] -5 hSpCas9 negative selection 4819678
69046474 69046496 9 - 27760321 HT29 viability after 7 days TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.756191729672959 [244,190] [171,146,178] -8 hSpCas9 negative selection 4819679
69053165 69053187 9 + 27760321 HT29 viability after 7 days AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -0.3777034125554808 [257,201] [252,293,141] -5 hSpCas9 negative selection 4819680
69035905 69035927 9 - 27760321 HT29 viability after 25 days CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -0.603778886603912 [247,193] [156,166,175] -5 hSpCas9 negative selection 4903139
69035938 69035960 9 - 27760321 HT29 viability after 25 days GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -1.8093594203832317 [847,661] [279,149,312] -8 hSpCas9 negative selection 4903140
69046380 69046402 9 + 27760321 HT29 viability after 25 days TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.8400627531541831 [234,183] [177,97,120] -6 hSpCas9 negative selection 4903141
69046474 69046496 9 - 27760321 HT29 viability after 25 days TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -1.0206913673538336 [244,190] [190,48,123] -6 hSpCas9 negative selection 4903142
69053165 69053187 9 + 27760321 HT29 viability after 25 days AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -3.2363985136669227 [257,201] [41,27,10] -8 hSpCas9 negative selection 4903143
69035905 69035927 9 - 27760321 HT29 viability after 22 days CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -0.49887920819679143 [247,193] [158,103,280] -4 hSpCas9 negative selection 4986602
69035938 69035960 9 - 27760321 HT29 viability after 22 days GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -1.432921905329896 [847,661] [571,182,206] -7 hSpCas9 negative selection 4986603
69046380 69046402 9 + 27760321 HT29 viability after 22 days TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.07745567823413635 [234,183] [406,68,286] 0 hSpCas9 negative selection 4986604
69046474 69046496 9 - 27760321 HT29 viability after 22 days TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.860176710640107 [244,190] [146,155,112] -6 hSpCas9 negative selection 4986605
69053165 69053187 9 + 27760321 HT29 viability after 22 days AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -3.0414334009716515 [257,201] [28,34,32] -8 hSpCas9 negative selection 4986606
69035905 69035927 9 - 27760321 HT29 viability after 19 days CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -0.9083957330694163 [247,193] [132,34,231] -6 hSpCas9 negative selection 5070065
69035938 69035960 9 - 27760321 HT29 viability after 19 days GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -1.4393364909076807 [847,661] [463,154,349] -7 hSpCas9 negative selection 5070066
69046380 69046402 9 + 27760321 HT29 viability after 19 days TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.08185320704353127 [234,183] [303,149,232] 0 hSpCas9 negative selection 5070067
69046474 69046496 9 - 27760321 HT29 viability after 19 days TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.9903936397693807 [244,190] [125,59,187] -6 hSpCas9 negative selection 5070068
69053165 69053187 9 + 27760321 HT29 viability after 19 days AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -0.5995696365813104 [257,201] [272,52,203] -5 hSpCas9 negative selection 5070069
69035905 69035927 9 - 27760321 HT29 viability after 16 days CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -1.5112291420934019 [247,193] [86,96,75] -8 hSpCas9 negative selection 5153528
69035938 69035960 9 - 27760321 HT29 viability after 16 days GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.7818554694443636 [847,661] [601,386,497] -6 hSpCas9 negative selection 5153529
69046380 69046402 9 + 27760321 HT29 viability after 16 days TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.45931681622286935 [234,183] [212,113,189] -5 hSpCas9 negative selection 5153530
69046474 69046496 9 - 27760321 HT29 viability after 16 days TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -1.1909640182183299 [244,190] [124,74,122] -7 hSpCas9 negative selection 5153531
69053165 69053187 9 + 27760321 HT29 viability after 16 days AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -1.4274715566474216 [257,201] [49,161,68] -8 hSpCas9 negative selection 5153532
69035905 69035927 9 - 27760321 HT29 viability after 13 days CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -0.5625873202187546 [247,193] [246,105,167] -6 hSpCas9 negative selection 5236991
69035938 69035960 9 - 27760321 HT29 viability after 13 days GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 -0.33245499446114624 [847,661] [632,606,837] -4 hSpCas9 negative selection 5236992
69046380 69046402 9 + 27760321 HT29 viability after 13 days TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.11294221282512118 [234,183] [305,210,270] 1 hSpCas9 negative selection 5236993
69046474 69046496 9 - 27760321 HT29 viability after 13 days TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.4792661039034294 [244,190] [64,170,300] -5 hSpCas9 negative selection 5236994
69053165 69053187 9 + 27760321 HT29 viability after 13 days AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -1.195039959837653 [257,201] [73,128,144] -8 hSpCas9 negative selection 5236995
69035905 69035927 9 - 27760321 HT29 viability after 10 days CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -0.8378935231336571 [247,193] [156,109,193] -7 hSpCas9 negative selection 5320454
69035938 69035960 9 - 27760321 HT29 viability after 10 days GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 0.14307682668246713 [847,661] [993,1007,1117] 1 hSpCas9 negative selection 5320455
69046380 69046402 9 + 27760321 HT29 viability after 10 days TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.4675873202682547 [234,183] [344,323,413] 6 hSpCas9 negative selection 5320456
69046474 69046496 9 - 27760321 HT29 viability after 10 days TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 -0.4208984829216478 [244,190] [228,354,33] -5 hSpCas9 negative selection 5320457
69053165 69053187 9 + 27760321 HT29 viability after 10 days AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 -0.13371510491560046 [257,201] [160,399,228] -2 hSpCas9 negative selection 5320458
69035905 69035927 9 - 27760321 MOLM13 viability CGCATCGATGTCGGTGCGCAGG FXN ENSG00000165060 -1.1298869825314792 [217,247] [45,72] -6 hSpCas9 negative selection 5403917
69035938 69035960 9 - 27760321 MOLM13 viability GCGGATACTTACTGCGCGGCGG FXN ENSG00000165060 3.45314250380466 [1019,847] [11285,1030] 9 hSpCas9 negative selection 5403918
69046380 69046402 9 + 27760321 MOLM13 viability TTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 1.2024991671854544 [286,234] [434,253] 8 hSpCas9 negative selection 5403919
69046474 69046496 9 - 27760321 MOLM13 viability TGTTTTATCTTACCCTGGGTGG FXN ENSG00000165060 1.2357142372594165 [291,244] [437,284] 8 hSpCas9 negative selection 5403920
69053165 69053187 9 + 27760321 MOLM13 viability AGACTAGCAGAGGAAACGCTGG FXN ENSG00000165060 0.43365135160674706 [276,257] [278,139] 3 hSpCas9 negative selection 5403921
69036190 69036213 9 + 27661255 K562 viability GCGACTGCGGGTCAAGGCACGGG FXN ENSG00000165060 0.013024353164804658 [72,171] [126,71] 0 dCas9-KRAB negative selection 5481090
69036247 69036270 9 - 27661255 K562 viability GGAGACAGCCGCACACCCCTCGG FXN ENSG00000165060 0.07850112302452972 [1501,1515] [1318,1232] 2 dCas9-KRAB negative selection 5481091
69035936 69035959 9 - 27260156 BXPC3 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.1506929372038543 [103] [26,41,55,76] -9 hSpCas9 negative selection 5544363
69035913 69035936 9 - 27260156 BXPC3 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.07118160603032475 [266] [267,261,231,302] -2 hSpCas9 negative selection 5544364
69046379 69046402 9 + 27260156 BXPC3 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.2721751887688756 [407] [286,374,346,414] -6 hSpCas9 negative selection 5544365
69037308 69037331 9 + 27260156 BXPC3 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.1890703524472519 [149] [132,168,277,135] 4 hSpCas9 negative selection 5583572
69064978 69065001 9 - 27260156 BXPC3 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.24556025705946638 [928] [781,848,705,950] -5 hSpCas9 negative selection 5608624
69053155 69053178 9 + 27260156 BXPC3 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -0.5593934866424105 [381] [200,245,261,397] -8 hSpCas9 negative selection 5608625
69064940 69064963 9 + 27260156 BXPC3 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.23398425562640068 [392] [492,500,406,530] 5 hSpCas9 negative selection 5608626
69035936 69035959 9 - 27260156 A673 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.7390305029239936 [103] [35,54,21,35] -9 hSpCas9 negative selection 5665614
69035913 69035936 9 - 27260156 A673 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.5325335822833224 [266] [231,144,343,163] -8 hSpCas9 negative selection 5665615
69046379 69046402 9 + 27260156 A673 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.3278982962595939 [407] [368,314,514,357] -7 hSpCas9 negative selection 5665616
69037308 69037331 9 + 27260156 A673 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.15021316361550396 [149] [150,147,196,150] -4 hSpCas9 negative selection 5704823
69064978 69065001 9 - 27260156 A673 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.36168833634849595 [928] [828,896,804,938] -7 hSpCas9 negative selection 5729875
69053155 69053178 9 + 27260156 A673 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.3614302481040674 [381] [163,164,162,222] -9 hSpCas9 negative selection 5729876
69064940 69064963 9 + 27260156 A673 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 -0.05474457135921451 [392] [538,416,335,540] -1 hSpCas9 negative selection 5729877
69035936 69035959 9 - 27260156 A375 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.7136357358159455 [103] [65,19,51,10] -9 hSpCas9 negative selection 5786865
69035913 69035936 9 - 27260156 A375 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.35794317261270137 [266] [182,271,148,357] -5 hSpCas9 negative selection 5786866
69046379 69046402 9 + 27260156 A375 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.6899040091791223 [407] [349,280,262,285] -7 hSpCas9 negative selection 5786867
69037308 69037331 9 + 27260156 A375 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.34753524980157247 [149] [119,234,138,76] -5 hSpCas9 negative selection 5826074
69064978 69065001 9 - 27260156 A375 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.9392356260821614 [928] [567,613,778,334] -8 hSpCas9 negative selection 5851126
69053155 69053178 9 + 27260156 A375 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -2.196409073360512 [381] [115,60,71,130] -9 hSpCas9 negative selection 5851127
69064940 69064963 9 + 27260156 A375 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.42239368371201935 [392] [680,481,724,558] 6 hSpCas9 negative selection 5851128
69035936 69035959 9 - 27260156 COLO741 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.530184621476611 [103] [17,5,42] -9 hSpCas9 negative selection 5908116
69035913 69035936 9 - 27260156 COLO741 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.44295821934803326 [266] [171,311,260] -7 hSpCas9 negative selection 5908117
69046379 69046402 9 + 27260156 COLO741 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.23865027656716278 [407] [483,513,337] -5 hSpCas9 negative selection 5908118
69037308 69037331 9 + 27260156 COLO741 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.42536828763456236 [149] [117,181,126] -7 hSpCas9 negative selection 5947325
69064978 69065001 9 - 27260156 COLO741 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.15459679463379805 [928] [1235,1092,894] -3 hSpCas9 negative selection 5972377
69053155 69053178 9 + 27260156 COLO741 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.2583298178957358 [381] [312,205,108] -9 hSpCas9 negative selection 5972378
69064940 69064963 9 + 27260156 COLO741 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.03243967867146705 [392] [492,491,549] 0 hSpCas9 negative selection 5972379
69035936 69035959 9 - 27260156 CAL120 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.1839147469820066 [103] [44,18,23] -9 hSpCas9 negative selection 6029367
69035913 69035936 9 - 27260156 CAL120 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -1.2532782050577713 [266] [104,173,133] -9 hSpCas9 negative selection 6029368
69046379 69046402 9 + 27260156 CAL120 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.2226801392800247 [407] [435,420,447] -3 hSpCas9 negative selection 6029369
69037308 69037331 9 + 27260156 CAL120 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.3216507628722789 [149] [122,206,350] 5 hSpCas9 negative selection 6068576
69064978 69065001 9 - 27260156 CAL120 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.5128065173328098 [928] [999,711,747] -6 hSpCas9 negative selection 6093628
69053155 69053178 9 + 27260156 CAL120 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.9583004153822468 [381] [109,128,125] -9 hSpCas9 negative selection 6093629
69064940 69064963 9 + 27260156 CAL120 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.46817774967637366 [392] [784,996,270] 7 hSpCas9 negative selection 6093630
69035936 69035959 9 - 27260156 CADOES1 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -0.9930131080414024 [103] [30,58,41,62] -9 hSpCas9 negative selection 6150618
69035913 69035936 9 - 27260156 CADOES1 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.3913171393908401 [266] [199,194,180,180] -6 hSpCas9 negative selection 6150619
69046379 69046402 9 + 27260156 CADOES1 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.0502973705014533 [407] [372,289,401,401] -1 hSpCas9 negative selection 6150620
69037308 69037331 9 + 27260156 CADOES1 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.010072421170369994 [149] [170,154,143,89] 0 hSpCas9 negative selection 6189827
69064978 69065001 9 - 27260156 CADOES1 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.20996746614852602 [928] [782,900,512,792] -4 hSpCas9 negative selection 6214879
69053155 69053178 9 + 27260156 CADOES1 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -0.6604964734785973 [381] [206,278,245,164] -8 hSpCas9 negative selection 6214880
69064940 69064963 9 + 27260156 CADOES1 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.5843507343876542 [392] [384,430,579,805] 8 hSpCas9 negative selection 6214881
69035936 69035959 9 - 27260156 EWS502 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.5771406372417234 [103] [36,21,9,0] -9 hSpCas9 negative selection 6271869
69035913 69035936 9 - 27260156 EWS502 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -1.0438851656956025 [266] [135,141,148,119] -9 hSpCas9 negative selection 6271870
69046379 69046402 9 + 27260156 EWS502 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.5634520231823749 [407] [262,327,312,264] -7 hSpCas9 negative selection 6271871
69037308 69037331 9 + 27260156 EWS502 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.3174415892037854 [149] [95,132,148,135] -5 hSpCas9 negative selection 6311078
69064978 69065001 9 - 27260156 EWS502 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.8773819948583811 [928] [508,639,409,581] -8 hSpCas9 negative selection 6336130
69053155 69053178 9 + 27260156 EWS502 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -2.530971008517696 [381] [75,73,69,57] -9 hSpCas9 negative selection 6336131
69064940 69064963 9 + 27260156 EWS502 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.368498555585387 [392] [532,374,583,672] 6 hSpCas9 negative selection 6336132
69035936 69035959 9 - 27260156 EW8 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.1921790515120216 [103] [44,36,44,19] -9 hSpCas9 negative selection 6393120
69035913 69035936 9 - 27260156 EW8 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.29781694667564595 [266] [195,132,154,224] -5 hSpCas9 negative selection 6393121
69046379 69046402 9 + 27260156 EW8 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.1425251245506344 [407] [416,321,231,250] -3 hSpCas9 negative selection 6393122
69037308 69037331 9 + 27260156 EW8 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.016902438533099806 [149] [112,231,64,90] 0 hSpCas9 negative selection 6432329
69064978 69065001 9 - 27260156 EW8 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.3688216230208151 [928] [730,583,385,678] -6 hSpCas9 negative selection 6457381
69053155 69053178 9 + 27260156 EW8 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.4255461644280483 [381] [132,66,158,95] -9 hSpCas9 negative selection 6457382
69064940 69064963 9 + 27260156 EW8 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.14158641470995603 [392] [427,347,272,376] 2 hSpCas9 negative selection 6457383
69035936 69035959 9 - 27260156 CORL105 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -0.962313498885703 [103] [96,21,81,53] -9 hSpCas9 negative selection 6514371
69035913 69035936 9 - 27260156 CORL105 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.9738751493552538 [266] [186,171,162,115] -9 hSpCas9 negative selection 6514372
69046379 69046402 9 + 27260156 CORL105 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.27531139053927134 [407] [399,370,437,376] -5 hSpCas9 negative selection 6514373
69037308 69037331 9 + 27260156 CORL105 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.30841610251870466 [149] [104,155,200,112] -5 hSpCas9 negative selection 6553580
69064978 69065001 9 - 27260156 CORL105 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.4158366754279421 [928] [698,693,908,970] -6 hSpCas9 negative selection 6578632
69053155 69053178 9 + 27260156 CORL105 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -0.7987754871654345 [381] [269,149,404,228] -8 hSpCas9 negative selection 6578633
69064940 69064963 9 + 27260156 CORL105 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.13241339338115393 [392] [525,476,639,396] 2 hSpCas9 negative selection 6578634
69035936 69035959 9 - 27260156 HS294T viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.6986207249544085 [103] [21,2,15,6] -9 hSpCas9 negative selection 6635622
69035913 69035936 9 - 27260156 HS294T viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.41639504914076886 [266] [78,60,69,103] -5 hSpCas9 negative selection 6635623
69046379 69046402 9 + 27260156 HS294T viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.5400192578374816 [407] [55,88,137,165] -6 hSpCas9 negative selection 6635624
69037308 69037331 9 + 27260156 HS294T viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.07068609720735575 [149] [73,40,35,70] -1 hSpCas9 negative selection 6674831
69064978 69065001 9 - 27260156 HS294T viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.404785734748641 [928] [148,350,249,357] -5 hSpCas9 negative selection 6699883
69053155 69053178 9 + 27260156 HS294T viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.3992594248936374 [381] [14,25,115,74] -9 hSpCas9 negative selection 6699884
69064940 69064963 9 + 27260156 HS294T viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.2962087758396215 [392] [140,115,281,218] 4 hSpCas9 negative selection 6699885
69035936 69035959 9 - 27260156 HCC44 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.3639324092022531 [103] [78,10,19,74] -9 hSpCas9 negative selection 6756873
69035913 69035936 9 - 27260156 HCC44 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.6979098999633948 [266] [158,64,237,300] -7 hSpCas9 negative selection 6756874
69046379 69046402 9 + 27260156 HCC44 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.1631400269077166 [407] [443,344,496,386] -3 hSpCas9 negative selection 6756875
69037308 69037331 9 + 27260156 HCC44 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.6092079214424639 [149] [87,92,180,94] -7 hSpCas9 negative selection 6796082
69064978 69065001 9 - 27260156 HCC44 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.6072418361135832 [928] [704,453,1014,670] -7 hSpCas9 negative selection 6821134
69053155 69053178 9 + 27260156 HCC44 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -2.322423001114453 [381] [34,29,238,70] -9 hSpCas9 negative selection 6821135
69064940 69064963 9 + 27260156 HCC44 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.07803479274730879 [392] [378,489,534,468] 1 hSpCas9 negative selection 6821136
69035936 69035959 9 - 27260156 G402 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.3822168235778438 [103] [15,73,3,94] -9 hSpCas9 negative selection 6878124
69035913 69035936 9 - 27260156 G402 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.6477450866279675 [266] [168,92,503,59] -7 hSpCas9 negative selection 6878125
69046379 69046402 9 + 27260156 G402 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.6117514906021947 [407] [219,423,230,412] -6 hSpCas9 negative selection 6878126
69037308 69037331 9 + 27260156 G402 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.5181528691115276 [149] [123,191,156,44] -6 hSpCas9 negative selection 6917333
69064978 69065001 9 - 27260156 G402 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -1.311375557613093 [928] [528,430,349,520] -9 hSpCas9 negative selection 6942385
69053155 69053178 9 + 27260156 G402 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.9310957606939358 [381] [35,360,36,58] -9 hSpCas9 negative selection 6942386
69064940 69064963 9 + 27260156 G402 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.49953375737317673 [392] [506,791,732,659] 6 hSpCas9 negative selection 6942387
69035936 69035959 9 - 27260156 L33 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.5284743922653425 [103] [6,21,37,23] -9 hSpCas9 negative selection 6999375
69035913 69035936 9 - 27260156 L33 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.1672625360932416 [266] [189,98,201,199] -4 hSpCas9 negative selection 6999376
69046379 69046402 9 + 27260156 L33 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.31070834332957886 [407] [484,219,308,510] 6 hSpCas9 negative selection 6999377
69037308 69037331 9 + 27260156 L33 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.002963928030685903 [149] [190,48,88,147] 0 hSpCas9 negative selection 7038584
69064978 69065001 9 - 27260156 L33 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 0.006469304073845272 [928] [1023,313,548,1064] 0 hSpCas9 negative selection 7063636
69053155 69053178 9 + 27260156 L33 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -0.6697672575678493 [381] [216,141,136,179] -9 hSpCas9 negative selection 7063637
69064940 69064963 9 + 27260156 L33 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.031185078051302273 [392] [495,176,218,327] 0 hSpCas9 negative selection 7063638
69035936 69035959 9 - 27260156 K562 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.2889576490027688 [103] [22,33,13,6] -9 hSpCas9 negative selection 7120626
69035913 69035936 9 - 27260156 K562 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 0.06236752394788314 [266] [139,450,288,124] 0 hSpCas9 negative selection 7120627
69046379 69046402 9 + 27260156 K562 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.2575225856117277 [407] [279,330,306,292] -3 hSpCas9 negative selection 7120628
69037308 69037331 9 + 27260156 K562 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.6244082231341179 [149] [15,70,56,182] -6 hSpCas9 negative selection 7159835
69064978 69065001 9 - 27260156 K562 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.35612219330126804 [928] [1023,634,449,510] -4 hSpCas9 negative selection 7184887
69053155 69053178 9 + 27260156 K562 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.2126810498505372 [381] [139,140,187,117] -8 hSpCas9 negative selection 7184888
69064940 69064963 9 + 27260156 K562 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 -0.14099036951307292 [392] [327,217,485,236] -2 hSpCas9 negative selection 7184889
69035936 69035959 9 - 27260156 HT29 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.8731731085946013 [103] [18,14,93,9] -9 hSpCas9 negative selection 7241877
69035913 69035936 9 - 27260156 HT29 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -1.1673010490081421 [266] [225,106,137,112] -9 hSpCas9 negative selection 7241878
69046379 69046402 9 + 27260156 HT29 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.3337165037099227 [407] [396,472,409,308] -6 hSpCas9 negative selection 7241879
69037308 69037331 9 + 27260156 HT29 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.6647297210487071 [149] [105,122,130,100] -8 hSpCas9 negative selection 7281086
69064978 69065001 9 - 27260156 HT29 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.7540627697151451 [928] [877,690,637,504] -8 hSpCas9 negative selection 7306138
69053155 69053178 9 + 27260156 HT29 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.6681015857836659 [381] [239,98,167,86] -9 hSpCas9 negative selection 7306139
69064940 69064963 9 + 27260156 HT29 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.1783659895590854 [392] [560,778,447,408] 3 hSpCas9 negative selection 7306140
69035936 69035959 9 - 27260156 MHHES1 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.4851684743335833 [103] [22,28,48,57] -9 hSpCas9 negative selection 7363128
69035913 69035936 9 - 27260156 MHHES1 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.7950931336552587 [266] [221,96,202,166] -9 hSpCas9 negative selection 7363129
69046379 69046402 9 + 27260156 MHHES1 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.20327223724495022 [407] [563,351,318,372] -4 hSpCas9 negative selection 7363130
69037308 69037331 9 + 27260156 MHHES1 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.12453658298033687 [149] [274,266,106,117] 2 hSpCas9 negative selection 7402337
69064978 69065001 9 - 27260156 MHHES1 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.3545842644667411 [928] [921,976,679,724] -6 hSpCas9 negative selection 7427389
69053155 69053178 9 + 27260156 MHHES1 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.38073666591873 [381] [181,114,165,185] -9 hSpCas9 negative selection 7427390
69064940 69064963 9 + 27260156 MHHES1 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.10397353642193818 [392] [530,633,438,341] 2 hSpCas9 negative selection 7427391
69035936 69035959 9 - 27260156 MEWO viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.50840194011038 [103] [30,14,7] -9 hSpCas9 negative selection 7484379
69035913 69035936 9 - 27260156 MEWO viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.7497976500505263 [266] [179,88,182] -9 hSpCas9 negative selection 7484380
69046379 69046402 9 + 27260156 MEWO viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.19900795715265548 [407] [429,206,379] -4 hSpCas9 negative selection 7484381
69037308 69037331 9 + 27260156 MEWO viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.029808640576356682 [149] [155,127,131] 0 hSpCas9 negative selection 7523588
69064978 69065001 9 - 27260156 MEWO viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.5670581561696171 [928] [792,550,455] -8 hSpCas9 negative selection 7548640
69053155 69053178 9 + 27260156 MEWO viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.2165391982278662 [381] [176,117,170] -9 hSpCas9 negative selection 7548641
69064940 69064963 9 + 27260156 MEWO viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 -0.15646844529492637 [392] [396,244,360] -3 hSpCas9 negative selection 7548642
69035936 69035959 9 - 27260156 LNCAPCLONEFGC viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.5284945390094924 [103] [2,22,28,11] -9 hSpCas9 negative selection 7605630
69035913 69035936 9 - 27260156 LNCAPCLONEFGC viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.7950871003711109 [266] [205,114,86,141] -8 hSpCas9 negative selection 7605631
69046379 69046402 9 + 27260156 LNCAPCLONEFGC viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.03277958435152031 [407] [283,433,390,336] 0 hSpCas9 negative selection 7605632
69037308 69037331 9 + 27260156 LNCAPCLONEFGC viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.09048104760501041 [149] [103,122,193,99] -1 hSpCas9 negative selection 7644839
69064978 69065001 9 - 27260156 LNCAPCLONEFGC viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.4833931821634517 [928] [607,558,607,635] -6 hSpCas9 negative selection 7669891
69053155 69053178 9 + 27260156 LNCAPCLONEFGC viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.3646820349062192 [381] [175,124,105,125] -9 hSpCas9 negative selection 7669892
69064940 69064963 9 + 27260156 LNCAPCLONEFGC viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.5213403519289668 [392] [542,452,586,474] 7 hSpCas9 negative selection 7669893
69035936 69035959 9 - 27260156 PANC0327 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.9378971718632503 [103] [62,20,1,13] -9 hSpCas9 negative selection 7726881
69035913 69035936 9 - 27260156 PANC0327 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -1.69000248403585 [266] [57,155,13,53] -9 hSpCas9 negative selection 7726882
69046379 69046402 9 + 27260156 PANC0327 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.5640396342002333 [407] [552,344,528,741] 8 hSpCas9 negative selection 7726883
69037308 69037331 9 + 27260156 PANC0327 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.08958399439110298 [149] [183,253,68,48] 1 hSpCas9 negative selection 7766090
69064978 69065001 9 - 27260156 PANC0327 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.6101970547710456 [928] [393,306,461,1016] -7 hSpCas9 negative selection 7791142
69053155 69053178 9 + 27260156 PANC0327 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.2395087810090795 [381] [207,112,116,145] -9 hSpCas9 negative selection 7791143
69064940 69064963 9 + 27260156 PANC0327 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.40066401732866985 [392] [734,219,521,419] 6 hSpCas9 negative selection 7791144
69035936 69035959 9 - 27260156 NCIH2009 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.984212125811098 [103] [37,14,5] -9 hSpCas9 negative selection 7848132
69035913 69035936 9 - 27260156 NCIH2009 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.8287772421287873 [266] [234,245,152] -7 hSpCas9 negative selection 7848133
69046379 69046402 9 + 27260156 NCIH2009 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.6366140082103494 [407] [445,313,355] -7 hSpCas9 negative selection 7848134
69037308 69037331 9 + 27260156 NCIH2009 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.5297077823445482 [149] [236,112,103] -6 hSpCas9 negative selection 7887341
69064978 69065001 9 - 27260156 NCIH2009 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -1.1832793108481816 [928] [607,565,546] -8 hSpCas9 negative selection 7912393
69053155 69053178 9 + 27260156 NCIH2009 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -2.569919577291494 [381] [164,53,65] -9 hSpCas9 negative selection 7912394
69064940 69064963 9 + 27260156 NCIH2009 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.3144472276644244 [392] [625,628,781] 4 hSpCas9 negative selection 7912395
69035936 69035959 9 - 27260156 NCIH1373 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -0.9519341874209353 [103] [139,4,56,14] -7 hSpCas9 negative selection 7969383
69035913 69035936 9 - 27260156 NCIH1373 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -1.3949771917853477 [266] [162,136,39,31] -8 hSpCas9 negative selection 7969384
69046379 69046402 9 + 27260156 NCIH1373 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.2715956019123673 [407] [595,366,475,212] 2 hSpCas9 negative selection 7969385
69037308 69037331 9 + 27260156 NCIH1373 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.41478909943021636 [149] [113,156,60,151] 4 hSpCas9 negative selection 8008592
69064978 69065001 9 - 27260156 NCIH1373 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.9316402805433421 [928] [684,244,654,171] -7 hSpCas9 negative selection 8033644
69053155 69053178 9 + 27260156 NCIH1373 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.8957830177842152 [381] [246,83,102,11] -9 hSpCas9 negative selection 8033645
69064940 69064963 9 + 27260156 NCIH1373 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.9834411936868896 [392] [598,626,1260,255] 8 hSpCas9 negative selection 8033646
69035936 69035959 9 - 27260156 PATU8902 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -0.3891217850961275 [103] [194,175,40,37] -4 hSpCas9 negative selection 8090634
69035913 69035936 9 - 27260156 PATU8902 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.7506592608865537 [266] [183,350,251,69] -6 hSpCas9 negative selection 8090635
69046379 69046402 9 + 27260156 PATU8902 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.7975643016048642 [407] [1305,938,924,756] 8 hSpCas9 negative selection 8090636
69037308 69037331 9 + 27260156 PATU8902 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -1.1139483019371326 [149] [19,55,221,49] -7 hSpCas9 negative selection 8129843
69064978 69065001 9 - 27260156 PATU8902 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.8232114165948596 [928] [727,771,585,889] -6 hSpCas9 negative selection 8154895
69053155 69053178 9 + 27260156 PATU8902 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.2896399932744587 [381] [165,251,216,236] -8 hSpCas9 negative selection 8154896
69064940 69064963 9 + 27260156 PATU8902 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.884612541646093 [392] [1022,791,717,1652] 8 hSpCas9 negative selection 8154897
69035936 69035959 9 - 27260156 PANC1 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.0598572197364828 [103] [84,31,38,15] -8 hSpCas9 negative selection 8211885
69035913 69035936 9 - 27260156 PANC1 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.5720355001121924 [266] [139,189,170,125] -7 hSpCas9 negative selection 8211886
69046379 69046402 9 + 27260156 PANC1 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.4523937696691913 [407] [277,305,239,212] -6 hSpCas9 negative selection 8211887
69037308 69037331 9 + 27260156 PANC1 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.48281770668729496 [149] [72,59,93,127] -6 hSpCas9 negative selection 8251094
69064978 69065001 9 - 27260156 PANC1 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.6550198059701939 [928] [560,776,427,334] -7 hSpCas9 negative selection 8276146
69053155 69053178 9 + 27260156 PANC1 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.4008448448884443 [381] [157,150,143,57] -9 hSpCas9 negative selection 8276147
69064940 69064963 9 + 27260156 PANC1 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.5425085853390854 [392] [457,536,479,492] 8 hSpCas9 negative selection 8276148
69035936 69035959 9 - 27260156 PANC0813 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -2.744584500693855 [103] [9,5,16,37] -9 hSpCas9 negative selection 8333136
69035913 69035936 9 - 27260156 PANC0813 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.9851525055290158 [266] [214,177,97,147] -8 hSpCas9 negative selection 8333137
69046379 69046402 9 + 27260156 PANC0813 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.745926202194348 [407] [303,385,207,247] -8 hSpCas9 negative selection 8333138
69037308 69037331 9 + 27260156 PANC0813 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 0.06703265011851811 [149] [294,167,154,132] 1 hSpCas9 negative selection 8372345
69064978 69065001 9 - 27260156 PANC0813 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.8428266742202181 [928] [808,571,554,519] -8 hSpCas9 negative selection 8397397
69053155 69053178 9 + 27260156 PANC0813 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.839273085631759 [381] [52,162,70,202] -9 hSpCas9 negative selection 8397398
69064940 69064963 9 + 27260156 PANC0813 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.310469063265463 [392] [549,460,573,694] 5 hSpCas9 negative selection 8397399
69035936 69035959 9 - 27260156 RDES viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -1.2226068698798498 [103] [36,96,18,46] -9 hSpCas9 negative selection 8454387
69035913 69035936 9 - 27260156 RDES viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.6110200795969105 [266] [172,161,183,303] -8 hSpCas9 negative selection 8454388
69046379 69046402 9 + 27260156 RDES viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 -0.13056125368143293 [407] [433,528,367,340] -2 hSpCas9 negative selection 8454389
69037308 69037331 9 + 27260156 RDES viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -2.8193820092337063e-05 [149] [136,136,194,237] 0 hSpCas9 negative selection 8493596
69064978 69065001 9 - 27260156 RDES viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 -0.2996914394778383 [928] [823,769,838,1056] -5 hSpCas9 negative selection 8518648
69053155 69053178 9 + 27260156 RDES viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -1.0969157232629694 [381] [164,138,145,409] -9 hSpCas9 negative selection 8518649
69064940 69064963 9 + 27260156 RDES viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.20085148905635258 [392] [408,404,623,689] 3 hSpCas9 negative selection 8518650
69035936 69035959 9 - 27260156 PC3 viability CGGATACTTACTGCGCGGCGGGG FXN ENSG00000165060 -0.9776466823920917 [103] [27,83,69,38] -9 hSpCas9 negative selection 8575638
69035913 69035936 9 - 27260156 PC3 viability CGTGCAGGTCGCATCGATGTCGG FXN ENSG00000165060 -0.470193940118816 [266] [92,195,265,273] -8 hSpCas9 negative selection 8575639
69046379 69046402 9 + 27260156 PC3 viability TTTCAGAGTTCGAACCAACGTGG FXN ENSG00000165060 0.19386772339009736 [407] [360,580,534,389] 4 hSpCas9 negative selection 8575640
69037308 69037331 9 + 27260156 PC3 viability AAAGAAAAGTTAGCCGGGCGTGG FXN ENSG00000165060 -0.35294224068723623 [149] [73,98,276,87] -7 hSpCas9 negative selection 8614847
69064978 69065001 9 - 27260156 PC3 viability CGTCTGCTTGTTGATCACATAGG FXN ENSG00000165060 0.03280563404524006 [928] [669,702,1797,985] 0 hSpCas9 negative selection 8639899
69053155 69053178 9 + 27260156 PC3 viability CACCTATGAAAGACTAGCAGAGG FXN ENSG00000165060 -0.7570728918925664 [381] [150,185,413,235] -9 hSpCas9 negative selection 8639900
69064940 69064963 9 + 27260156 PC3 viability TGGTGTCTTAACTGTCAAACTGG FXN ENSG00000165060 0.15997580906440212 [392] [302,361,784,453] 3 hSpCas9 negative selection 8639901