Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 65018
  • Symbol: PINK1
  • Description: PTEN induced kinase 1
DataSource: http://genomecrispr.dkfz.de/#!/results/PINK1

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
20633856 20633879 1 - 26472758 Jiyoye viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.7333058420439569 [96] [43] -5 hSpCas9 negative selection 120888
20638043 20638066 1 + 26472758 Jiyoye viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -0.0623099017953469 [89] [64] 0 hSpCas9 negative selection 120889
20637849 20637872 1 + 26472758 Jiyoye viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.1288775187343365 [57] [39] -1 hSpCas9 negative selection 120890
20639948 20639971 1 + 26472758 Jiyoye viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.017763689902524138 [92] [70] 0 hSpCas9 negative selection 120891
20633578 20633601 1 - 26472758 Jiyoye viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 -0.4571695191365603 [141] [77] -3 hSpCas9 negative selection 120892
20637982 20638005 1 + 26472758 Jiyoye viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 0.3400611856473361 [21] [20] 2 hSpCas9 negative selection 120893
20637998 20638021 1 + 26472758 Jiyoye viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 0.4467037456925107 [35] [36] 3 hSpCas9 negative selection 120894
20633856 20633879 1 - 26472758 KBM7 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.33573934344071343 [499,229] [121,139] -3 hSpCas9 negative selection 312006
20638043 20638066 1 + 26472758 KBM7 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -1.0084928130992936 [239,249] [82,34] -7 hSpCas9 negative selection 312007
20637849 20637872 1 + 26472758 KBM7 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.7496262957704423 [191,160] [83,17] -6 hSpCas9 negative selection 312008
20639948 20639971 1 + 26472758 KBM7 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 -0.3297508221080638 [760,461] [154,285] -3 hSpCas9 negative selection 312009
20633578 20633601 1 - 26472758 KBM7 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.5654692905446119 [708,607] [393,512] 6 hSpCas9 negative selection 312010
20637982 20638005 1 + 26472758 KBM7 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 1.3763646353161845 [55,69] [46,105] 9 hSpCas9 negative selection 312011
20637998 20638021 1 + 26472758 KBM7 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -0.47230935363043947 [237,238] [104,59] -4 hSpCas9 negative selection 312012
20633856 20633879 1 - 26472758 Raji viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 0.15417774685254063 [181] [46] 1 hSpCas9 negative selection 503124
20638043 20638066 1 + 26472758 Raji viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -0.04461955807145046 [199] [44] 0 hSpCas9 negative selection 503125
20637849 20637872 1 + 26472758 Raji viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 1.2892218583594126 [66] [37] 9 hSpCas9 negative selection 503126
20639948 20639971 1 + 26472758 Raji viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.33076174085560306 [208] [60] 3 hSpCas9 negative selection 503127
20633578 20633601 1 - 26472758 Raji viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.4650335524949234 [358] [114] 4 hSpCas9 negative selection 503128
20637982 20638005 1 + 26472758 Raji viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 1.1654864899371677 [72] [37] 8 hSpCas9 negative selection 503129
20637998 20638021 1 + 26472758 Raji viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 0.3277736037988994 [102] [29] 3 hSpCas9 negative selection 503130
20633856 20633879 1 - 26472758 K562 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.611505094660132 [218] [120] -4 hSpCas9 negative selection 694242
20638043 20638066 1 + 26472758 K562 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 0.8794219108871986 [254] [395] 7 hSpCas9 negative selection 694243
20637849 20637872 1 + 26472758 K562 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.8616229097438775 [126] [58] -5 hSpCas9 negative selection 694244
20639948 20639971 1 + 26472758 K562 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 -0.6238505739147644 [386] [211] -4 hSpCas9 negative selection 694245
20633578 20633601 1 - 26472758 K562 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.661941490334885 [434] [580] 5 hSpCas9 negative selection 694246
20637982 20638005 1 + 26472758 K562 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 -1.8365012677171206 [109] [25] -7 hSpCas9 negative selection 694247
20637998 20638021 1 + 26472758 K562 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -0.24951959935931223 [237] [168] -2 hSpCas9 negative selection 694248
20633830 20633853 1 - 26627737 DLD1 viability GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.44666466570784824 [417] [122,47,111] -4 hSpCas9 negative selection 768879
20638098 20638121 1 - 26627737 DLD1 viability CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.4873108620075367 [768] [469,274,272] 5 hSpCas9 negative selection 768880
20633830 20633853 1 - 26627737 GBM cells viability after 5 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.32009590705611035 [141] [89,31] -5 hSpCas9 negative selection 851194
20638098 20638121 1 - 26627737 GBM cells viability after 5 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.5759519605052209 [348] [318,238] 8 hSpCas9 negative selection 851195
20633830 20633853 1 - 26627737 GBM cells viability after 13 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.6962259421286973 [141] [46,47] -7 hSpCas9 negative selection 933509
20638098 20638121 1 - 26627737 GBM cells viability after 13 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.6831218747987698 [348] [308,299] 8 hSpCas9 negative selection 933510
20633830 20633853 1 - 26627737 GBM cells viability after 21 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 0.3290763588629075 [141] [98,94] 3 hSpCas9 negative selection 1015824
20638098 20638121 1 - 26627737 GBM cells viability after 21 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.5473551238871398 [348] [274,278] 5 hSpCas9 negative selection 1015825
20633830 20633853 1 - 26627737 RPE1 viability after 9 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 0.66284240383462 [522] [277,234] 4 hSpCas9 negative selection 1098139
20638098 20638121 1 - 26627737 RPE1 viability after 9 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -1.0529983166425205 [2024] [236,393] -6 hSpCas9 negative selection 1098140
20633830 20633853 1 - 26627737 RPE1 viability after 12 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 0.6755568186627889 [522] [238,208] 4 hSpCas9 negative selection 1180454
20638098 20638121 1 - 26627737 RPE1 viability after 12 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.5861556358273388 [2024] [324,401] -4 hSpCas9 negative selection 1180455
20633830 20633853 1 - 26627737 RPE1 viability after 15 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 0.7433947456082944 [522] [293,202] 4 hSpCas9 negative selection 1262769
20638098 20638121 1 - 26627737 RPE1 viability after 15 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -1.4091869351536888 [2024] [120,306] -7 hSpCas9 negative selection 1262770
20633830 20633853 1 - 26627737 RPE1 viability after 18 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 1.0090852597717634 [522] [387,172] 6 hSpCas9 negative selection 1345084
20638098 20638121 1 - 26627737 RPE1 viability after 18 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -1.00077996888855 [2024] [304,238] -6 hSpCas9 negative selection 1345085
20633830 20633853 1 - 26627737 HeLa viability after 8 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -1.342058289508915 [496] [85,142,30] -8 hSpCas9 negative selection 1427399
20638098 20638121 1 - 26627737 HeLa viability after 8 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.46977775580233627 [630] [152,176,250] -4 hSpCas9 negative selection 1427400
20633830 20633853 1 - 26627737 HeLa viability after 12 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.6327200205862414 [496] [289,37,83] -5 hSpCas9 negative selection 1509714
20638098 20638121 1 - 26627737 HeLa viability after 12 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.3744248811216817 [630] [373,216,436] 3 hSpCas9 negative selection 1509715
20633830 20633853 1 - 26627737 HeLa viability after 15 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -2.2788494576998675 [496] [49,44,28] -9 hSpCas9 negative selection 1592029
20638098 20638121 1 - 26627737 HeLa viability after 15 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.09957106221628342 [630] [50,400,384] 0 hSpCas9 negative selection 1592030
20633830 20633853 1 - 26627737 HeLa viability after 18 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -2.2291456627427344 [496] [34,38,28] -9 hSpCas9 negative selection 1674344
20638098 20638121 1 - 26627737 HeLa viability after 18 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.07442729746629939 [630] [28,326,384] 0 hSpCas9 negative selection 1674345
20633830 20633853 1 - 26627737 HCT116 viability after 6 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.4307525243567456 [257] [22,33] -2 hSpCas9 negative selection 1756659
20638098 20638121 1 - 26627737 HCT116 viability after 6 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -1.1361808249298138 [863] [84,48] -6 hSpCas9 negative selection 1756660
20633830 20633853 1 - 26627737 HCT116 viability after 8 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.42274823752944557 [201] [52,147,47] -5 hSpCas9 negative selection 1838974
20638098 20638121 1 - 26627737 HCT116 viability after 8 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.4074431015811524 [398] [235,133,128] -5 hSpCas9 negative selection 1838975
20633830 20633853 1 - 26627737 HCT116 viability after 9 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.662845836696756 [257] [71,20] -5 hSpCas9 negative selection 1921289
20638098 20638121 1 - 26627737 HCT116 viability after 9 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 1.2745031047552204 [863] [413,671] 8 hSpCas9 negative selection 1921290
20633830 20633853 1 - 26627737 HCT116 viability after 12 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.780883577694986 [201] [10,151,28] -7 hSpCas9 negative selection 2003604
20638098 20638121 1 - 26627737 HCT116 viability after 12 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.09193360025859432 [398] [262,138,180] -1 hSpCas9 negative selection 2003605
20633830 20633853 1 - 26627737 HCT116 viability after 15 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.5209626988643469 [201] [61,159,18] -5 hSpCas9 negative selection 2085919
20638098 20638121 1 - 26627737 HCT116 viability after 15 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.09160587800956971 [398] [298,181,257] 0 hSpCas9 negative selection 2085920
20633830 20633853 1 - 26627737 HCT116 viability after 18 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.4816672913024841 [201] [23,129,50] -4 hSpCas9 negative selection 2168234
20638098 20638121 1 - 26627737 HCT116 viability after 18 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.34296728177357094 [398] [143,148,163] -3 hSpCas9 negative selection 2168235
20633542 20633565 1 + 24336569 HL60 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 1.3886779980904018 [426] [2365] 8 hSpCas9 negative selection 2284196
20633547 20633570 1 - 24336569 HL60 viability CAGCGCCTGTCGCACCGCCATGG PINK1 ENSG00000158828 0.41397247146389493 [553] [1561] 4 hSpCas9 negative selection 2284197
20633555 20633578 1 + 24336569 HL60 viability GTGCGACAGGCGCTGGGCCGCGG PINK1 ENSG00000158828 -0.3465758214952991 [833] [1387] -3 hSpCas9 negative selection 2284198
20633572 20633595 1 - 24336569 HL60 viability CTCGACCCAGCTGCAGGCCGCGG PINK1 ENSG00000158828 -0.05371050117871412 [797] [1626] 0 hSpCas9 negative selection 2284199
20633578 20633601 1 - 24336569 HL60 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 1.1166732943379893 [466] [2142] 8 hSpCas9 negative selection 2284200
20633593 20633616 1 + 24336569 HL60 viability AGCGCTGCTGCTGCGCTTCACGG PINK1 ENSG00000158828 0.7733695315955911 [268] [972] 6 hSpCas9 negative selection 2284201
20633603 20633626 1 + 24336569 HL60 viability CTGCGCTTCACGGGCAAGCCCGG PINK1 ENSG00000158828 -0.15249533956131311 [280] [534] -1 hSpCas9 negative selection 2284202
20633608 20633631 1 + 24336569 HL60 viability CTTCACGGGCAAGCCCGGCCGGG PINK1 ENSG00000158828 0.21610271116432644 [859] [2113] 2 hSpCas9 negative selection 2284203
20633615 20633638 1 + 24336569 HL60 viability GGCAAGCCCGGCCGGGCCTACGG PINK1 ENSG00000158828 -0.054250913939280165 [813] [1658] 0 hSpCas9 negative selection 2284204
20633542 20633565 1 + 24336569 KBM7 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 1.0405011076263062 [484] [2720] 8 hSpCas9 negative selection 2351373
20633547 20633570 1 - 24336569 KBM7 viability CAGCGCCTGTCGCACCGCCATGG PINK1 ENSG00000158828 0.9941262531920412 [267] [1455] 8 hSpCas9 negative selection 2351374
20633555 20633578 1 + 24336569 KBM7 viability GTGCGACAGGCGCTGGGCCGCGG PINK1 ENSG00000158828 0.9046849767094386 [479] [2450] 7 hSpCas9 negative selection 2351375
20633572 20633595 1 - 24336569 KBM7 viability CTCGACCCAGCTGCAGGCCGCGG PINK1 ENSG00000158828 0.548240287512597 [431] [1722] 5 hSpCas9 negative selection 2351376
20633578 20633601 1 - 24336569 KBM7 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.8397027555315889 [530] [2591] 7 hSpCas9 negative selection 2351377
20633593 20633616 1 + 24336569 KBM7 viability AGCGCTGCTGCTGCGCTTCACGG PINK1 ENSG00000158828 0.5401424736726809 [412] [1637] 5 hSpCas9 negative selection 2351378
20633603 20633626 1 + 24336569 KBM7 viability CTGCGCTTCACGGGCAAGCCCGG PINK1 ENSG00000158828 0.8523225920084809 [131] [649] 7 hSpCas9 negative selection 2351379
20633608 20633631 1 + 24336569 KBM7 viability CTTCACGGGCAAGCCCGGCCGGG PINK1 ENSG00000158828 0.1368838424948291 [962] [2887] 1 hSpCas9 negative selection 2351380
20633615 20633638 1 + 24336569 KBM7 viability GGCAAGCCCGGCCGGGCCTACGG PINK1 ENSG00000158828 0.8699029933072879 [519] [2591] 7 hSpCas9 negative selection 2351381
20638010 20638033 1 + 27260157 DLD1 viability AAGAGCACCGGGTTGCTTCCAGG PINK1 ENSG00000158828 0.31695185303721 [] [] 4 hSpCas9 negative selection 2574287
20633615 20633638 1 + 27260157 DLD1 viability GGCAAGCCCGGCCGGGCCTACGG PINK1 ENSG00000158828 -0.0579397064940917 [] [] 0 hSpCas9 negative selection 2574563
20633572 20633595 1 - 27260157 DLD1 viability CTCGACCCAGCTGCAGGCCGCGG PINK1 ENSG00000158828 0.164433467104678 [] [] 3 hSpCas9 negative selection 2582300
20637920 20637943 1 + 27260157 DLD1 viability TATCTGATAGGGCAGTCCATTGG PINK1 ENSG00000158828 -0.417688393977316 [] [] -3 hSpCas9 negative selection 2586094
20637892 20637915 1 + 27260157 DLD1 viability ACGCTTGCAGGGCTTTCGGCTGG PINK1 ENSG00000158828 -1.00945694721381 [] [] -7 hSpCas9 negative selection 2608333
20633593 20633616 1 + 27260157 DLD1 viability AGCGCTGCTGCTGCGCTTCACGG PINK1 ENSG00000158828 1.12677598136121 [] [] 9 hSpCas9 negative selection 2610191
20633603 20633626 1 + 27260157 DLD1 viability CTGCGCTTCACGGGCAAGCCCGG PINK1 ENSG00000158828 0.750975243472424 [] [] 8 hSpCas9 negative selection 2616411
20633544 20633567 1 - 27260157 DLD1 viability CGCCTGTCGCACCGCCATGGTGG PINK1 ENSG00000158828 -0.127450901558246 [] [] -1 hSpCas9 negative selection 2616876
20633608 20633631 1 + 27260157 DLD1 viability CTTCACGGGCAAGCCCGGCCGGG PINK1 ENSG00000158828 1.01979381792929 [] [] 9 hSpCas9 negative selection 2617289
20637908 20637931 1 + 27260157 DLD1 viability CGGCTGGAGGAGTATCTGATAGG PINK1 ENSG00000158828 1.26871518140891 [] [] 9 hSpCas9 negative selection 2619306
20633547 20633570 1 - 27260157 DLD1 viability CAGCGCCTGTCGCACCGCCATGG PINK1 ENSG00000158828 -0.611074328944944 [] [] -5 hSpCas9 negative selection 2620848
20633542 20633565 1 + 27260157 DLD1 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.0629190566207834 [] [] 0 hSpCas9 negative selection 2641841
20633578 20633601 1 - 27260157 DLD1 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.468991371660988 [] [] 8 hSpCas9 negative selection 2642690
20633555 20633578 1 + 27260157 DLD1 viability GTGCGACAGGCGCTGGGCCGCGG PINK1 ENSG00000158828 0.604671026970134 [] [] 8 hSpCas9 negative selection 2644000
20638010 20638033 1 + 27260157 HT1080 viability AAGAGCACCGGGTTGCTTCCAGG PINK1 ENSG00000158828 0.577604064115464 [] [] 5 hSpCas9 negative selection 2650417
20633615 20633638 1 + 27260157 HT1080 viability GGCAAGCCCGGCCGGGCCTACGG PINK1 ENSG00000158828 0.233827036872955 [] [] 2 hSpCas9 negative selection 2650693
20633572 20633595 1 - 27260157 HT1080 viability CTCGACCCAGCTGCAGGCCGCGG PINK1 ENSG00000158828 0.883916348979331 [] [] 7 hSpCas9 negative selection 2658430
20637920 20637943 1 + 27260157 HT1080 viability TATCTGATAGGGCAGTCCATTGG PINK1 ENSG00000158828 0.344067144748386 [] [] 3 hSpCas9 negative selection 2662224
20637892 20637915 1 + 27260157 HT1080 viability ACGCTTGCAGGGCTTTCGGCTGG PINK1 ENSG00000158828 -0.606907365987048 [] [] -8 hSpCas9 negative selection 2684463
20633593 20633616 1 + 27260157 HT1080 viability AGCGCTGCTGCTGCGCTTCACGG PINK1 ENSG00000158828 0.864498124816602 [] [] 7 hSpCas9 negative selection 2686321
20633603 20633626 1 + 27260157 HT1080 viability CTGCGCTTCACGGGCAAGCCCGG PINK1 ENSG00000158828 0.190330907098101 [] [] 1 hSpCas9 negative selection 2692541
20633544 20633567 1 - 27260157 HT1080 viability CGCCTGTCGCACCGCCATGGTGG PINK1 ENSG00000158828 -0.556436666939641 [] [] -7 hSpCas9 negative selection 2693006
20633608 20633631 1 + 27260157 HT1080 viability CTTCACGGGCAAGCCCGGCCGGG PINK1 ENSG00000158828 0.2932329796645 [] [] 2 hSpCas9 negative selection 2693419
20637908 20637931 1 + 27260157 HT1080 viability CGGCTGGAGGAGTATCTGATAGG PINK1 ENSG00000158828 1.38420467206426 [] [] 9 hSpCas9 negative selection 2695436
20633547 20633570 1 - 27260157 HT1080 viability CAGCGCCTGTCGCACCGCCATGG PINK1 ENSG00000158828 0.14902038189597 [] [] 1 hSpCas9 negative selection 2696978
20633542 20633565 1 + 27260157 HT1080 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.142825929071004 [] [] 0 hSpCas9 negative selection 2717971
20633578 20633601 1 - 27260157 HT1080 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.399645635317933 [] [] 3 hSpCas9 negative selection 2718820
20633555 20633578 1 + 27260157 HT1080 viability GTGCGACAGGCGCTGGGCCGCGG PINK1 ENSG00000158828 -0.126608479443674 [] [] 0 hSpCas9 negative selection 2720130
20638010 20638033 1 + 27260157 MKN45 viability AAGAGCACCGGGTTGCTTCCAGG PINK1 ENSG00000158828 1.23359906803592 [] [] 9 hSpCas9 negative selection 2726547
20633615 20633638 1 + 27260157 MKN45 viability GGCAAGCCCGGCCGGGCCTACGG PINK1 ENSG00000158828 0.0971104057496694 [] [] 0 hSpCas9 negative selection 2726823
20633572 20633595 1 - 27260157 MKN45 viability CTCGACCCAGCTGCAGGCCGCGG PINK1 ENSG00000158828 0.216324666933662 [] [] 5 hSpCas9 negative selection 2734560
20637920 20637943 1 + 27260157 MKN45 viability TATCTGATAGGGCAGTCCATTGG PINK1 ENSG00000158828 -0.773806329586565 [] [] -7 hSpCas9 negative selection 2738354
20637892 20637915 1 + 27260157 MKN45 viability ACGCTTGCAGGGCTTTCGGCTGG PINK1 ENSG00000158828 -0.247685789047553 [] [] -1 hSpCas9 negative selection 2760593
20633593 20633616 1 + 27260157 MKN45 viability AGCGCTGCTGCTGCGCTTCACGG PINK1 ENSG00000158828 1.93616317451936 [] [] 9 hSpCas9 negative selection 2762451
20633603 20633626 1 + 27260157 MKN45 viability CTGCGCTTCACGGGCAAGCCCGG PINK1 ENSG00000158828 1.5202824695951 [] [] 9 hSpCas9 negative selection 2768671
20633544 20633567 1 - 27260157 MKN45 viability CGCCTGTCGCACCGCCATGGTGG PINK1 ENSG00000158828 1.57668513618802 [] [] 9 hSpCas9 negative selection 2769136
20633608 20633631 1 + 27260157 MKN45 viability CTTCACGGGCAAGCCCGGCCGGG PINK1 ENSG00000158828 0.0422912808087104 [] [] 0 hSpCas9 negative selection 2769549
20637908 20637931 1 + 27260157 MKN45 viability CGGCTGGAGGAGTATCTGATAGG PINK1 ENSG00000158828 0.249759187455625 [] [] 5 hSpCas9 negative selection 2771566
20633547 20633570 1 - 27260157 MKN45 viability CAGCGCCTGTCGCACCGCCATGG PINK1 ENSG00000158828 -0.212711645061471 [] [] -1 hSpCas9 negative selection 2773108
20633542 20633565 1 + 27260157 MKN45 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -1.05661353195087 [] [] -8 hSpCas9 negative selection 2794101
20633578 20633601 1 - 27260157 MKN45 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 -0.144518695697425 [] [] 0 hSpCas9 negative selection 2794950
20633555 20633578 1 + 27260157 MKN45 viability GTGCGACAGGCGCTGGGCCGCGG PINK1 ENSG00000158828 0.208566073367534 [] [] 5 hSpCas9 negative selection 2796260
20638010 20638033 1 + 27260157 RKO viability AAGAGCACCGGGTTGCTTCCAGG PINK1 ENSG00000158828 0.627512722977119 [] [] 3 hSpCas9 negative selection 2802677
20633615 20633638 1 + 27260157 RKO viability GGCAAGCCCGGCCGGGCCTACGG PINK1 ENSG00000158828 -0.497735594506027 [] [] -6 hSpCas9 negative selection 2802953
20633572 20633595 1 - 27260157 RKO viability CTCGACCCAGCTGCAGGCCGCGG PINK1 ENSG00000158828 0.286531454249271 [] [] 1 hSpCas9 negative selection 2810690
20637920 20637943 1 + 27260157 RKO viability TATCTGATAGGGCAGTCCATTGG PINK1 ENSG00000158828 0.521478087990322 [] [] 2 hSpCas9 negative selection 2814484
20637892 20637915 1 + 27260157 RKO viability ACGCTTGCAGGGCTTTCGGCTGG PINK1 ENSG00000158828 -0.374221011601738 [] [] -6 hSpCas9 negative selection 2836723
20633593 20633616 1 + 27260157 RKO viability AGCGCTGCTGCTGCGCTTCACGG PINK1 ENSG00000158828 0.694431882555518 [] [] 8 hSpCas9 negative selection 2838581
20633603 20633626 1 + 27260157 RKO viability CTGCGCTTCACGGGCAAGCCCGG PINK1 ENSG00000158828 0.694823376314937 [] [] 8 hSpCas9 negative selection 2844801
20633544 20633567 1 - 27260157 RKO viability CGCCTGTCGCACCGCCATGGTGG PINK1 ENSG00000158828 -0.29079060325458 [] [] -6 hSpCas9 negative selection 2845266
20633608 20633631 1 + 27260157 RKO viability CTTCACGGGCAAGCCCGGCCGGG PINK1 ENSG00000158828 0.671887149026039 [] [] 7 hSpCas9 negative selection 2845679
20637908 20637931 1 + 27260157 RKO viability CGGCTGGAGGAGTATCTGATAGG PINK1 ENSG00000158828 0.315835056146474 [] [] 1 hSpCas9 negative selection 2847696
20633547 20633570 1 - 27260157 RKO viability CAGCGCCTGTCGCACCGCCATGG PINK1 ENSG00000158828 0.437527400806596 [] [] 2 hSpCas9 negative selection 2849238
20633542 20633565 1 + 27260157 RKO viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.637261826813839 [] [] -7 hSpCas9 negative selection 2870231
20633578 20633601 1 - 27260157 RKO viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.229219653211955 [] [] 1 hSpCas9 negative selection 2871080
20633555 20633578 1 + 27260157 RKO viability GTGCGACAGGCGCTGGGCCGCGG PINK1 ENSG00000158828 -0.365717283860502 [] [] -6 hSpCas9 negative selection 2872390
20638010 20638033 1 + 27260157 SF268 viability AAGAGCACCGGGTTGCTTCCAGG PINK1 ENSG00000158828 0.139202517095041 [] [] 0 hSpCas9 negative selection 2878807
20633615 20633638 1 + 27260157 SF268 viability GGCAAGCCCGGCCGGGCCTACGG PINK1 ENSG00000158828 -0.257162892730493 [] [] -2 hSpCas9 negative selection 2879083
20633572 20633595 1 - 27260157 SF268 viability CTCGACCCAGCTGCAGGCCGCGG PINK1 ENSG00000158828 0.780228063018255 [] [] 8 hSpCas9 negative selection 2886820
20637920 20637943 1 + 27260157 SF268 viability TATCTGATAGGGCAGTCCATTGG PINK1 ENSG00000158828 0.245768488983797 [] [] 3 hSpCas9 negative selection 2890614
20637892 20637915 1 + 27260157 SF268 viability ACGCTTGCAGGGCTTTCGGCTGG PINK1 ENSG00000158828 -0.865091792057655 [] [] -6 hSpCas9 negative selection 2912853
20633593 20633616 1 + 27260157 SF268 viability AGCGCTGCTGCTGCGCTTCACGG PINK1 ENSG00000158828 0.456285737960558 [] [] 7 hSpCas9 negative selection 2914711
20633603 20633626 1 + 27260157 SF268 viability CTGCGCTTCACGGGCAAGCCCGG PINK1 ENSG00000158828 1.32498646946382 [] [] 9 hSpCas9 negative selection 2920931
20633544 20633567 1 - 27260157 SF268 viability CGCCTGTCGCACCGCCATGGTGG PINK1 ENSG00000158828 0.913365813706155 [] [] 9 hSpCas9 negative selection 2921396
20633608 20633631 1 + 27260157 SF268 viability CTTCACGGGCAAGCCCGGCCGGG PINK1 ENSG00000158828 0.269196011372612 [] [] 4 hSpCas9 negative selection 2921809
20637908 20637931 1 + 27260157 SF268 viability CGGCTGGAGGAGTATCTGATAGG PINK1 ENSG00000158828 -0.0219030388971104 [] [] 0 hSpCas9 negative selection 2923826
20633547 20633570 1 - 27260157 SF268 viability CAGCGCCTGTCGCACCGCCATGG PINK1 ENSG00000158828 -0.229566044620447 [] [] -2 hSpCas9 negative selection 2925368
20633542 20633565 1 + 27260157 SF268 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.86138519726821 [] [] -6 hSpCas9 negative selection 2946361
20633578 20633601 1 - 27260157 SF268 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.7892669606261 [] [] 8 hSpCas9 negative selection 2947210
20633555 20633578 1 + 27260157 SF268 viability GTGCGACAGGCGCTGGGCCGCGG PINK1 ENSG00000158828 -0.487522096581837 [] [] -4 hSpCas9 negative selection 2948520
20637927 20637950 1 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity ATAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 -0.2212641892293028 [3,3] [2,2] -3 hSpCas9 positive selection 3011435
20633876 20633899 1 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CCTCATCGAGGAAAAACAGGCGG PINK1 ENSG00000158828 -0.5663964332159406 [2,3] [0,1] -7 hSpCas9 positive selection 3011436
20637850 20637873 1 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.22398045544906192 [2,2] [2,0] -3 hSpCas9 positive selection 3011437
20637927 20637950 1 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity ATAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 -0.6890172284490523 [3,3] [2,0] -8 hSpCas9 positive selection 3079293
20633876 20633899 1 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CCTCATCGAGGAAAAACAGGCGG PINK1 ENSG00000158828 0.028869085578124787 [2,2] [3,1] 0 hSpCas9 positive selection 3079294
20637850 20637873 1 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.6754658584374141 [2,2] [0,0] -8 hSpCas9 positive selection 3079295
20633542 20633565 + 24336571 A375 resistance to PLX after 7 days CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.2253343018592493 [9,8] [6,8] -7 hSpCas9 positive selection 3135702
20633542 20633565 + 24336571 A375 resistance to PLX after 14 days CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -1.33476709218562 [8,13] [1,1] -9 hSpCas9 positive selection 3193495
20633542 20633565 + 24336571 A375 viability after 7 days CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.7259823512403446 [5] [9,8] 9 hSpCas9 negative selection 3251288
20633542 20633565 + 24336571 A375 viability after 14 days CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.9403734638454466 [5] [8,13] 9 hSpCas9 negative selection 3309081
20637878 20637901 1 - 27383988 293T resistance to West Nile virus (flavivirus) TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -1.2464995265499157 [362,362] [0,0] -8 hSpCas9 positive selection 3385935
20637880 20637903 1 + 27383988 293T resistance to West Nile virus (flavivirus) GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 3.087401210003523 [17,17] [0,0] 8 hSpCas9 positive selection 3385936
20637926 20637949 1 + 26780180 HT29 viability (Avana library 4 designs) ATAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.0450815023124328 [] [] 0 hSpCas9 negative selection 3449522
20633875 20633898 1 + 26780180 HT29 viability (Avana library 4 designs) CCTCATCGAGGAAAAACAGGCGG PINK1 ENSG00000158828 1.80989991719352 [] [] 7 hSpCas9 negative selection 3449523
20637849 20637872 1 + 26780180 HT29 viability (Avana library 4 designs) TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 1.79112932958978 [] [] 6 hSpCas9 negative selection 3449524
20637849 20637872 1 + 26780180 A375 viability (Avana lentiCRISPRv2) TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -2.33755479311851 [] [] -3 hSpCas9 negative selection 3544323
20633875 20633898 1 + 26780180 A375 viability (Avana lentiCRISPRv2) CCTCATCGAGGAAAAACAGGCGG PINK1 ENSG00000158828 -8.29562707063481 [] [] -7 hSpCas9 negative selection 3544324
20637926 20637949 1 + 26780180 A375 viability (Avana lentiCRISPRv2) ATAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 1.88900344066635 [] [] 2 hSpCas9 negative selection 3544325
20638044 20638067 1 + 26780180 A375 viability (Avana lentiCRISPRv2) GTACCAGTGCACCAGGAGAAGGG PINK1 ENSG00000158828 3.36060262406536 [] [] 5 hSpCas9 negative selection 3544326
20633839 20633862 1 - 26780180 A375 viability (Avana lentiCRISPRv2) CGAAGGCCAGAAAGACTGCCCGG PINK1 ENSG00000158828 4.7467094952624 [] [] 7 hSpCas9 negative selection 3544327
20637849 20637872 1 + 26780180 A375 viability (Avana lentiGuide) TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 11.3048287624423 [] [] 7 hSpCas9 negative selection 3652982
20633875 20633898 1 + 26780180 A375 viability (Avana lentiGuide) CCTCATCGAGGAAAAACAGGCGG PINK1 ENSG00000158828 -6.88610406543148 [] [] -9 hSpCas9 negative selection 3652983
20637926 20637949 1 + 26780180 A375 viability (Avana lentiGuide) ATAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 3.39642841715513 [] [] 3 hSpCas9 negative selection 3652984
20638044 20638067 1 + 26780180 A375 viability (Avana lentiGuide) GTACCAGTGCACCAGGAGAAGGG PINK1 ENSG00000158828 9.72425708122571 [] [] 6 hSpCas9 negative selection 3652985
20633839 20633862 1 - 26780180 A375 viability (Avana lentiGuide) CGAAGGCCAGAAAGACTGCCCGG PINK1 ENSG00000158828 -3.16742732966291 [] [] -5 hSpCas9 negative selection 3652986
20637849 20637872 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.3991585145831838 [4] [3,2] -5 hSpCas9 positive selection 3761641
20633875 20633898 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CCTCATCGAGGAAAAACAGGCGG PINK1 ENSG00000158828 -0.22867324108805737 [4] [2,3] -4 hSpCas9 positive selection 3761642
20637926 20637949 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ATAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.17437602074854958 [5] [6,6] 5 hSpCas9 positive selection 3761643
20638044 20638067 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GTACCAGTGCACCAGGAGAAGGG PINK1 ENSG00000158828 0.249307962683674 [4] [6,5] 7 hSpCas9 positive selection 3761644
20633839 20633862 1 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CGAAGGCCAGAAAGACTGCCCGG PINK1 ENSG00000158828 0.29776840700660534 [5] [6,6] 8 hSpCas9 positive selection 3761645
20637849 20637872 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.7319935821299604 [4] [1,1] -7 hSpCas9 positive selection 3870248
20633875 20633898 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CCTCATCGAGGAAAAACAGGCGG PINK1 ENSG00000158828 -0.23393616021724134 [4] [4,1] -3 hSpCas9 positive selection 3870249
20637926 20637949 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ATAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 -0.0017189902775519795 [5] [3,5] 0 hSpCas9 positive selection 3870250
20638044 20638067 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GTACCAGTGCACCAGGAGAAGGG PINK1 ENSG00000158828 -0.07467043714635213 [5] [3,4] -1 hSpCas9 positive selection 3870251
20633839 20633862 1 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CGAAGGCCAGAAAGACTGCCCGG PINK1 ENSG00000158828 0.30830850838782814 [6] [7,6] 8 hSpCas9 positive selection 3870252
20633542 20633565 1 + 26780180 A375 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.599330537389809 [] [] 1 hSpCas9 negative selection 3981063
20637880 20637903 1 + 26780180 A375 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.252015982649234 [] [] 0 hSpCas9 negative selection 3981064
20637878 20637901 1 - 26780180 A375 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.553212387064934 [] [] 1 hSpCas9 negative selection 3981065
20633542 20633565 1 + 26780180 HT29 viability (GeCKOv2 library) CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 1.25807091273962 [] [] 6 hSpCas9 negative selection 4089029
20637880 20637903 1 + 26780180 HT29 viability (GeCKOv2 library) GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.740533219358222 [] [] 3 hSpCas9 negative selection 4089030
20637878 20637901 1 - 26780180 HT29 viability (GeCKOv2 library) TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.674006473673657 [] [] 2 hSpCas9 negative selection 4089031
20633542 20633565 1 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.3019542766076331 [2] [1,0] -6 hSpCas9 positive selection 4160656
20633542 20633565 1 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.21353314140219018 [3] [2,2,1,0] 1 hSpCas9 positive selection 4224678
20633542 20633565 1 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.22191763152999755 [1] [1,1] 4 hSpCas9 positive selection 4290339
20637878 20637901 1 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.09523605847313038 [4] [3,2] 2 hSpCas9 positive selection 4354592
20637880 20637903 1 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.1784034833266146 [0] [1,0] 3 hSpCas9 positive selection 4354593
20633831 20633853 1 - 27760321 OCIAML3 viability GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.5551736332305248 [1002,751] [853,1189] 6 hSpCas9 negative selection 4427934
20637872 20637894 1 - 27760321 OCIAML3 viability GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 -0.14156572334322537 [759,728] [486,582] -1 hSpCas9 negative selection 4427935
20637927 20637949 1 + 27760321 OCIAML3 viability TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.8250921236328681 [204,164] [273,229] 8 hSpCas9 negative selection 4427936
20637975 20637997 1 - 27760321 OCIAML3 viability TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.350732702896929 [450,415] [473,377] 4 hSpCas9 negative selection 4427937
20639937 20639959 1 + 27760321 OCIAML3 viability CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.48216449218119295 [387,423] [443,449] 6 hSpCas9 negative selection 4427938
20633831 20633853 1 - 27760321 OCIAML2 viability GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.36185716277822233 [1002,751] [932,866] 5 hSpCas9 negative selection 4511397
20637872 20637894 1 - 27760321 OCIAML2 viability GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 0.1782685228996045 [759,728] [600,789] 2 hSpCas9 negative selection 4511398
20637927 20637949 1 + 27760321 OCIAML2 viability TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.5001661422422166 [204,164] [159,276] 6 hSpCas9 negative selection 4511399
20637975 20637997 1 - 27760321 OCIAML2 viability TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.42428293698961317 [450,415] [511,415] 6 hSpCas9 negative selection 4511400
20639937 20639959 1 + 27760321 OCIAML2 viability CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.1801298838431534 [387,423] [356,397] 2 hSpCas9 negative selection 4511401
20633831 20633853 1 - 27760321 MV411 viability GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.16816377508356806 [1002,751] [342,1098] 1 hSpCas9 negative selection 4594860
20637872 20637894 1 - 27760321 MV411 viability GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 -1.2515233199042275 [759,728] [51,438] -7 hSpCas9 negative selection 4594861
20637927 20637949 1 + 27760321 MV411 viability TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.4171648821116415 [204,164] [46,334] 3 hSpCas9 negative selection 4594862
20637975 20637997 1 - 27760321 MV411 viability TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.829774948586632 [450,415] [559,430] 6 hSpCas9 negative selection 4594863
20639937 20639959 1 + 27760321 MV411 viability CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.030423236056144526 [387,423] [183,412] 0 hSpCas9 negative selection 4594864
20633831 20633853 1 - 27760321 HL60 viability GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.2811049727278747 [1002,751] [967,752] 3 hSpCas9 negative selection 4678323
20637872 20637894 1 - 27760321 HL60 viability GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 -0.016248660736983056 [759,728] [545,661] 0 hSpCas9 negative selection 4678324
20637927 20637949 1 + 27760321 HL60 viability TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.5580823377665003 [204,164] [295,141] 6 hSpCas9 negative selection 4678325
20637975 20637997 1 - 27760321 HL60 viability TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.022776279697903266 [450,415] [317,403] 0 hSpCas9 negative selection 4678326
20639937 20639959 1 + 27760321 HL60 viability CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.5169307621064113 [387,423] [505,447] 6 hSpCas9 negative selection 4678327
20633831 20633853 1 - 27760321 HT1080 viability GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 1.3689822917583938 [751,586] [833,529] 7 hSpCas9 negative selection 4761786
20637872 20637894 1 - 27760321 HT1080 viability GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 -0.8414447234966796 [728,568] [44,252] -4 hSpCas9 negative selection 4761787
20637927 20637949 1 + 27760321 HT1080 viability TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 3.4325975533868416 [164,128] [776,473] 9 hSpCas9 negative selection 4761788
20637975 20637997 1 - 27760321 HT1080 viability TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.6578498141239488 [415,324] [261,200] 3 hSpCas9 negative selection 4761789
20639937 20639959 1 + 27760321 HT1080 viability CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.23134203739898918 [423,330] [187,163] 1 hSpCas9 negative selection 4761790
20633831 20633853 1 - 27760321 HT29 viability after 7 days GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.3460028656897437 [751,586] [1081,1039,1154] 5 hSpCas9 negative selection 4845249
20637872 20637894 1 - 27760321 HT29 viability after 7 days GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 0.07884679974836528 [728,568] [1058,823,787] 1 hSpCas9 negative selection 4845250
20637927 20637949 1 + 27760321 HT29 viability after 7 days TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.5671581433932933 [164,128] [420,258,182] 8 hSpCas9 negative selection 4845251
20637975 20637997 1 - 27760321 HT29 viability after 7 days TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 -0.23249664737089182 [415,324] [396,486,332] -3 hSpCas9 negative selection 4845252
20639937 20639959 1 + 27760321 HT29 viability after 7 days CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.007956664196309055 [423,330] [525,554,390] 0 hSpCas9 negative selection 4845253
20633831 20633853 1 - 27760321 HT29 viability after 25 days GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.6791595499967592 [751,586] [1138,1391,1138] 7 hSpCas9 negative selection 4928712
20637872 20637894 1 - 27760321 HT29 viability after 25 days GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 -0.0835761312763833 [728,568] [552,596,987] -1 hSpCas9 negative selection 4928713
20637927 20637949 1 + 27760321 HT29 viability after 25 days TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.25633762604432686 [164,128] [108,353,137] 2 hSpCas9 negative selection 4928714
20637975 20637997 1 - 27760321 HT29 viability after 25 days TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.11017255361089422 [415,324] [280,492,624] 1 hSpCas9 negative selection 4928715
20639937 20639959 1 + 27760321 HT29 viability after 25 days CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.22234387892235175 [423,330] [470,417,635] 2 hSpCas9 negative selection 4928716
20633831 20633853 1 - 27760321 HT29 viability after 22 days GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.7037648820420702 [751,586] [1180,1652,946] 7 hSpCas9 negative selection 5012175
20637872 20637894 1 - 27760321 HT29 viability after 22 days GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 -0.0838330022074284 [728,568] [674,598,851] -1 hSpCas9 negative selection 5012176
20637927 20637949 1 + 27760321 HT29 viability after 22 days TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.7053051543563438 [164,128] [272,222,335] 7 hSpCas9 negative selection 5012177
20637975 20637997 1 - 27760321 HT29 viability after 22 days TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 -0.17613685115972744 [415,324] [314,450,372] -2 hSpCas9 negative selection 5012178
20639937 20639959 1 + 27760321 HT29 viability after 22 days CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.1915788921737716 [423,330] [499,403,591] 2 hSpCas9 negative selection 5012179
20633831 20633853 1 - 27760321 HT29 viability after 19 days GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.5656594748942513 [751,586] [1278,1421,728] 5 hSpCas9 negative selection 5095638
20637872 20637894 1 - 27760321 HT29 viability after 19 days GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 0.1384627891354524 [728,568] [739,578,1111] 1 hSpCas9 negative selection 5095639
20637927 20637949 1 + 27760321 HT29 viability after 19 days TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 1.1687856617075936 [164,128] [328,564,239] 9 hSpCas9 negative selection 5095640
20637975 20637997 1 - 27760321 HT29 viability after 19 days TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.3756005504841379 [415,324] [476,417,738] 3 hSpCas9 negative selection 5095641
20639937 20639959 1 + 27760321 HT29 viability after 19 days CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 -0.29531680264274196 [423,330] [460,235,368] -3 hSpCas9 negative selection 5095642
20633831 20633853 1 - 27760321 HT29 viability after 16 days GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.7416817478083614 [751,586] [1483,1143,1153] 8 hSpCas9 negative selection 5179101
20637872 20637894 1 - 27760321 HT29 viability after 16 days GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 -0.2279174410662571 [728,568] [697,859,302] -3 hSpCas9 negative selection 5179102
20637927 20637949 1 + 27760321 HT29 viability after 16 days TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.5980984049805035 [164,128] [194,202,344] 7 hSpCas9 negative selection 5179103
20637975 20637997 1 - 27760321 HT29 viability after 16 days TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.10664641595955802 [415,324] [225,413,678] 1 hSpCas9 negative selection 5179104
20639937 20639959 1 + 27760321 HT29 viability after 16 days CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.45772194158444696 [423,330] [549,396,794] 5 hSpCas9 negative selection 5179105
20633831 20633853 1 - 27760321 HT29 viability after 13 days GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.7506933123248286 [751,586] [902,1722,1295] 8 hSpCas9 negative selection 5262564
20637872 20637894 1 - 27760321 HT29 viability after 13 days GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 0.08429701229162834 [728,568] [726,789,872] 1 hSpCas9 negative selection 5262565
20637927 20637949 1 + 27760321 HT29 viability after 13 days TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.7479804149192517 [164,128] [343,345,175] 8 hSpCas9 negative selection 5262566
20637975 20637997 1 - 27760321 HT29 viability after 13 days TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.26835929466675246 [415,324] [278,677,591] 3 hSpCas9 negative selection 5262567
20639937 20639959 1 + 27760321 HT29 viability after 13 days CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 0.33953539525865684 [423,330] [627,544,492] 4 hSpCas9 negative selection 5262568
20633831 20633853 1 - 27760321 HT29 viability after 10 days GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 0.610543610093608 [751,586] [1002,1624,1211] 8 hSpCas9 negative selection 5346027
20637872 20637894 1 - 27760321 HT29 viability after 10 days GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 0.32927209675184865 [728,568] [1120,730,1189] 4 hSpCas9 negative selection 5346028
20637927 20637949 1 + 27760321 HT29 viability after 10 days TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.4267056816626281 [164,128] [234,268,236] 6 hSpCas9 negative selection 5346029
20637975 20637997 1 - 27760321 HT29 viability after 10 days TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 0.39787315813771457 [415,324] [738,621,470] 5 hSpCas9 negative selection 5346030
20639937 20639959 1 + 27760321 HT29 viability after 10 days CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 -0.20176249769844315 [423,330] [433,370,422] -3 hSpCas9 negative selection 5346031
20633831 20633853 1 - 27760321 MOLM13 viability GAAAGACTGCCCGGCCGCAAGG PINK1 ENSG00000158828 1.3820166196177104 [1002,751] [1313,1249] 8 hSpCas9 negative selection 5429490
20637872 20637894 1 - 27760321 MOLM13 viability GTCTCGTGTCCAACGGGTCAGG PINK1 ENSG00000158828 0.5476899558445366 [759,728] [675,562] 4 hSpCas9 negative selection 5429491
20637927 20637949 1 + 27760321 MOLM13 viability TAGGGCAGTCCATTGGTAAGGG PINK1 ENSG00000158828 0.17493411624195887 [204,164] [208,38] 1 hSpCas9 negative selection 5429492
20637975 20637997 1 - 27760321 MOLM13 viability TTCTGGGGCAATGTAGGCATGG PINK1 ENSG00000158828 1.446551124374241 [450,415] [893,472] 8 hSpCas9 negative selection 5429493
20639937 20639959 1 + 27760321 MOLM13 viability CTGGTCCCAGCGAGCCGAGTGG PINK1 ENSG00000158828 1.027209100042711 [387,423] [468,470] 7 hSpCas9 negative selection 5429494
20633533 20633556 1 + 27661255 K562 viability GGGCCGCGGCGCCACCATGGCGG PINK1 ENSG00000158828 -0.08826232537780154 [1106,1301] [950,860] -3 dCas9-KRAB negative selection 5501989
20633943 20633966 1 + 27661255 K562 viability GGGCCGGGTCCTAAGCCGAGCGG PINK1 ENSG00000158828 0.15952823411197764 [457,609] [534,421] 5 dCas9-KRAB negative selection 5501990
20633902 20633925 1 - 27661255 K562 viability GACAGGCCGAGACCGCCCGCCGG PINK1 ENSG00000158828 0.0564104044815604 [852,773] [792,577] 2 dCas9-KRAB negative selection 5501991
20633919 20633942 1 - 27661255 K562 viability GCTCACCTGGATCTCCTGACAGG PINK1 ENSG00000158828 0.06398371392237179 [249,195] [179,192] 2 dCas9-KRAB negative selection 5501992
20633542 20633565 1 + 27260156 BXPC3 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.08654952267663218 [142] [77,118,246,208] 2 hSpCas9 negative selection 5562799
20637878 20637901 1 - 27260156 BXPC3 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.10418004949770654 [1062] [1068,993,964,1106] -2 hSpCas9 negative selection 5627052
20637880 20637903 1 + 27260156 BXPC3 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.4442489078119527 [43] [43,74,47,86] 8 hSpCas9 negative selection 5627053
20633542 20633565 1 + 27260156 A673 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.04756852521272448 [142] [156,224,148,174] 1 hSpCas9 negative selection 5684050
20637878 20637901 1 - 27260156 A673 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.07420240995531158 [1062] [1301,1093,1137,1333] -2 hSpCas9 negative selection 5748303
20637880 20637903 1 + 27260156 A673 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.015694396973712 [43] [53,51,23,80] 0 hSpCas9 negative selection 5748304
20633542 20633565 1 + 27260156 A375 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.10533035725551487 [142] [161,245,73,237] 1 hSpCas9 negative selection 5805301
20637878 20637901 1 - 27260156 A375 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.09599400089971777 [1062] [1031,1687,1023,990] -1 hSpCas9 negative selection 5869554
20637880 20637903 1 + 27260156 A375 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.7395049063374706 [43] [102,40,145,50] 9 hSpCas9 negative selection 5869555
20633542 20633565 1 + 27260156 COLO741 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.048955385034249455 [142] [179,148,198] -1 hSpCas9 negative selection 5926552
20637878 20637901 1 - 27260156 COLO741 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.1299917092828331 [1062] [1324,1388,1029] -3 hSpCas9 negative selection 5990805
20637880 20637903 1 + 27260156 COLO741 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.11175505333548719 [43] [34,3,110] -2 hSpCas9 negative selection 5990806
20633542 20633565 1 + 27260156 CAL120 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.6556971963110851 [142] [67,147,115] -7 hSpCas9 negative selection 6047803
20637878 20637901 1 - 27260156 CAL120 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.22104959022240522 [1062] [1306,1041,1081] -3 hSpCas9 negative selection 6112056
20637880 20637903 1 + 27260156 CAL120 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.28660342018032425 [43] [100,10,92] 4 hSpCas9 negative selection 6112057
20633542 20633565 1 + 27260156 CADOES1 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.3178368447541233 [142] [155,112,202,191] 5 hSpCas9 negative selection 6169054
20637878 20637901 1 - 27260156 CADOES1 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.17006609272403517 [1062] [1097,998,1115,1240] 3 hSpCas9 negative selection 6233307
20637880 20637903 1 + 27260156 CADOES1 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.20946738490453054 [43] [74,37,58,15] 3 hSpCas9 negative selection 6233308
20633542 20633565 1 + 27260156 EWS502 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.02159443439939146 [142] [147,177,66,224] 0 hSpCas9 negative selection 6290305
20637878 20637901 1 - 27260156 EWS502 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.05766009493384616 [1062] [1481,1048,781,1343] 1 hSpCas9 negative selection 6354558
20637880 20637903 1 + 27260156 EWS502 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.06357019389507501 [43] [56,3,20,99] -1 hSpCas9 negative selection 6354559
20633542 20633565 1 + 27260156 EW8 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.38250815933900917 [142] [210,176,131,93] 7 hSpCas9 negative selection 6411556
20637878 20637901 1 - 27260156 EW8 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.04814871734033055 [1062] [1103,817,807,634] -1 hSpCas9 negative selection 6475809
20637880 20637903 1 + 27260156 EW8 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.14916492698438866 [43] [44,9,48,22] -3 hSpCas9 negative selection 6475810
20633542 20633565 1 + 27260156 CORL105 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.2520814439161114 [142] [209,118,273,207] 5 hSpCas9 negative selection 6532807
20637878 20637901 1 - 27260156 CORL105 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.1815771236567123 [1062] [1241,1362,1641,1428] 3 hSpCas9 negative selection 6597060
20637880 20637903 1 + 27260156 CORL105 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.0747640962759859 [43] [70,79,23,16] -1 hSpCas9 negative selection 6597061
20633542 20633565 1 + 27260156 HS294T viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.38093053234642094 [142] [65,76,88,52] 5 hSpCas9 negative selection 6654058
20637878 20637901 1 - 27260156 HS294T viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.16461317562852318 [1062] [294,636,409,518] 2 hSpCas9 negative selection 6718311
20637880 20637903 1 + 27260156 HS294T viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.11327442077028982 [43] [27,9,20,12] 1 hSpCas9 negative selection 6718312
20633542 20633565 1 + 27260156 HCC44 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.2867707235468635 [142] [110,163,135,112] -4 hSpCas9 negative selection 6775309
20637878 20637901 1 - 27260156 HCC44 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.0074721203062060315 [1062] [1534,1009,1164,1118] 0 hSpCas9 negative selection 6839562
20637880 20637903 1 + 27260156 HCC44 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.036838630863908595 [43] [38,53,73,29] 0 hSpCas9 negative selection 6839563
20633542 20633565 1 + 27260156 G402 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.47603211101464726 [142] [217,68,132,92] -5 hSpCas9 negative selection 6896560
20637878 20637901 1 - 27260156 G402 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.3554185842369396 [1062] [1137,1003,1022,908] -4 hSpCas9 negative selection 6960813
20637880 20637903 1 + 27260156 G402 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.3161676898366892 [43] [15,65,28,57] -4 hSpCas9 negative selection 6960814
20633542 20633565 1 + 27260156 L33 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.4211767590579938 [142] [193,95,105,168] 8 hSpCas9 negative selection 7017811
20637878 20637901 1 - 27260156 L33 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.020515466806071858 [1062] [1087,385,722,1131] 0 hSpCas9 negative selection 7082064
20637880 20637903 1 + 27260156 L33 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.15991569506872683 [43] [17,30,50,22] 3 hSpCas9 negative selection 7082065
20633542 20633565 1 + 27260156 K562 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.5318293736747677 [142] [102,114,90,48] -6 hSpCas9 negative selection 7139062
20637878 20637901 1 - 27260156 K562 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.10179732388651841 [1062] [1256,626,1075,1076] 1 hSpCas9 negative selection 7203315
20637880 20637903 1 + 27260156 K562 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.9185275523162875 [43] [4,50,232,6] 9 hSpCas9 negative selection 7203316
20633542 20633565 1 + 27260156 HT29 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.12160526657503312 [142] [98,187,65,268] -3 hSpCas9 negative selection 7260313
20637878 20637901 1 - 27260156 HT29 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.06196182900674985 [1062] [1412,1491,1303,820] -1 hSpCas9 negative selection 7324566
20637880 20637903 1 + 27260156 HT29 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.6079276066214807 [43] [24,8,75,27] -7 hSpCas9 negative selection 7324567
20633542 20633565 1 + 27260156 MHHES1 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.26503780679554323 [142] [139,146,159,96] -5 hSpCas9 negative selection 7381564
20637878 20637901 1 - 27260156 MHHES1 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.19789452640519556 [1062] [1279,980,1333,668] -4 hSpCas9 negative selection 7445817
20637880 20637903 1 + 27260156 MHHES1 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.17120571940480334 [43] [35,59,52,67] 3 hSpCas9 negative selection 7445818
20633542 20633565 1 + 27260156 MEWO viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.42910963473079233 [142] [108,86,103] -7 hSpCas9 negative selection 7502815
20637878 20637901 1 - 27260156 MEWO viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.27448033948561523 [1062] [1016,650,836] -5 hSpCas9 negative selection 7567068
20637880 20637903 1 + 27260156 MEWO viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.28519505129935707 [43] [41,18,41] -6 hSpCas9 negative selection 7567069
20633542 20633565 1 + 27260156 LNCAPCLONEFGC viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.28287745770212136 [142] [112,130,105,73] -4 hSpCas9 negative selection 7624066
20637878 20637901 1 - 27260156 LNCAPCLONEFGC viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.008184326971441669 [1062] [1171,637,1110,990] 0 hSpCas9 negative selection 7688319
20637880 20637903 1 + 27260156 LNCAPCLONEFGC viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.28485970433970786 [43] [28,45,18,33] -4 hSpCas9 negative selection 7688320
20633542 20633565 1 + 27260156 PANC0327 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.27743293424604243 [142] [112,242,156,87] 4 hSpCas9 negative selection 7745317
20637878 20637901 1 - 27260156 PANC0327 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.07641738554497746 [1062] [927,677,1082,923] -1 hSpCas9 negative selection 7809570
20637880 20637903 1 + 27260156 PANC0327 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.0068481460561899965 [43] [37,34,31,50] 0 hSpCas9 negative selection 7809571
20633542 20633565 1 + 27260156 NCIH2009 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.8205466420485507 [142] [397,345,322] 9 hSpCas9 negative selection 7866568
20637878 20637901 1 - 27260156 NCIH2009 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.08516911061366716 [1062] [1903,1450,1435] 1 hSpCas9 negative selection 7930821
20637880 20637903 1 + 27260156 NCIH2009 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.9727790162824173 [43] [63,95,190] 9 hSpCas9 negative selection 7930822
20633542 20633565 1 + 27260156 NCIH1373 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -1.0092754105805128 [142] [50,58,173,6] -7 hSpCas9 negative selection 7987819
20637878 20637901 1 - 27260156 NCIH1373 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.24574143161134798 [1062] [1405,888,1962,375] 2 hSpCas9 negative selection 8052072
20637880 20637903 1 + 27260156 NCIH1373 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.02811854807170988 [43] [35,32,101,4] 0 hSpCas9 negative selection 8052073
20633542 20633565 1 + 27260156 PATU8902 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.4016883069865247 [142] [282,30,93,213] -4 hSpCas9 negative selection 8109070
20637878 20637901 1 - 27260156 PATU8902 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.13466465978128062 [1062] [1247,1174,1085,2023] -1 hSpCas9 negative selection 8173323
20637880 20637903 1 + 27260156 PATU8902 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.5231494293671912 [43] [28,57,5,92] -5 hSpCas9 negative selection 8173324
20633542 20633565 1 + 27260156 PANC1 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.38691934936427597 [142] [83,144,37,113] -6 hSpCas9 negative selection 8230321
20637878 20637901 1 - 27260156 PANC1 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.07843891645401047 [1062] [648,1458,616,846] -1 hSpCas9 negative selection 8294574
20637880 20637903 1 + 27260156 PANC1 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.01062614275800522 [43] [34,40,8,60] 0 hSpCas9 negative selection 8294575
20633542 20633565 1 + 27260156 PANC0813 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.22857248567147748 [142] [387,193,131,95] 3 hSpCas9 negative selection 8351572
20637878 20637901 1 - 27260156 PANC0813 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.22154527539313773 [1062] [1086,934,1088,1166] -4 hSpCas9 negative selection 8415825
20637880 20637903 1 + 27260156 PANC0813 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.9542920304294511 [43] [104,132,136,29] 9 hSpCas9 negative selection 8415826
20633542 20633565 1 + 27260156 RDES viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.00579370276509894 [142] [187,156,153,147] 0 hSpCas9 negative selection 8472823
20637878 20637901 1 - 27260156 RDES viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.018656102000833563 [1062] [1136,1201,1168,1307] 0 hSpCas9 negative selection 8537076
20637880 20637903 1 + 27260156 RDES viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.3589024948144832 [43] [58,38,82,83] 6 hSpCas9 negative selection 8537077
20633542 20633565 1 + 27260156 PC3 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.7653503069499656 [142] [73,31,197,71] -9 hSpCas9 negative selection 8594074
20637878 20637901 1 - 27260156 PC3 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.0629967139571479 [1062] [696,949,1766,1362] 1 hSpCas9 negative selection 8658327
20637880 20637903 1 + 27260156 PC3 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -1.0666855391612091 [43] [33,10,17,8] -9 hSpCas9 negative selection 8658328
20633542 20633565 1 + 27260156 PATU8988T viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.0520786944591185 [142] [109,68,271,68] -1 hSpCas9 negative selection 8715325
20637878 20637901 1 - 27260156 PATU8988T viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.042243172029701626 [1062] [1052,1059,1184,919] 0 hSpCas9 negative selection 8779578
20637880 20637903 1 + 27260156 PATU8988T viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.6941768400251171 [43] [128,50,35,56] 9 hSpCas9 negative selection 8779579
20633542 20633565 1 + 27260156 T47D viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 -0.4908875038058622 [142] [110,108,108,146] -8 hSpCas9 negative selection 8836576
20637878 20637901 1 - 27260156 T47D viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.09830618856827167 [1062] [1379,1302,1296,1324] 2 hSpCas9 negative selection 8900829
20637880 20637903 1 + 27260156 T47D viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.06780214817586128 [43] [37,38,71,46] -1 hSpCas9 negative selection 8900830
20633542 20633565 1 + 27260156 SU8686 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.2328214082610458 [142] [169,136,179,184] 4 hSpCas9 negative selection 8957827
20637878 20637901 1 - 27260156 SU8686 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.0495253624293146 [1062] [1029,989,1062,979] -1 hSpCas9 negative selection 9022080
20637880 20637903 1 + 27260156 SU8686 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 1.437964392779169 [43] [132,34,210,101] 9 hSpCas9 negative selection 9022081
20633542 20633565 1 + 27260156 SKES1 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.10579211763753449 [142] [85,201,149,168] 2 hSpCas9 negative selection 9079078
20637878 20637901 1 - 27260156 SKES1 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.09640958655899756 [1062] [1090,1085,989,833] -2 hSpCas9 negative selection 9143331
20637880 20637903 1 + 27260156 SKES1 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -1.1078645168441832 [43] [8,15,33,19] -9 hSpCas9 negative selection 9143332
20633542 20633565 1 + 27260156 TOV112D viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.14750653113273593 [142] [99,200,187,150] 3 hSpCas9 negative selection 9200329
20637878 20637901 1 - 27260156 TOV112D viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.01938658859438891 [1062] [1028,1329,717,1288] 0 hSpCas9 negative selection 9264582
20637880 20637903 1 + 27260156 TOV112D viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 -0.4782494833116848 [43] [69,38,7,14] -7 hSpCas9 negative selection 9264583
20633542 20633565 1 + 27260156 TC71 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.24639438339586572 [142] [244,167,127,186] 6 hSpCas9 negative selection 9321580
20637878 20637901 1 - 27260156 TC71 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 -0.013622407589898522 [1062] [1142,1097,1075,1203] 0 hSpCas9 negative selection 9385833
20637880 20637903 1 + 27260156 TC71 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.33568170411410225 [43] [61,33,34,110] 7 hSpCas9 negative selection 9385834
20633542 20633565 1 + 27260156 TC32 viability CGCCACCATGGCGGTGCGACAGG PINK1 ENSG00000158828 0.06370390087292743 [142] [79,193,121,139] 1 hSpCas9 negative selection 9442831
20637878 20637901 1 - 27260156 TC32 viability TGCAAGCGTCTCGTGTCCAACGG PINK1 ENSG00000158828 0.11919132921392994 [1062] [1001,847,1495,1100] 2 hSpCas9 negative selection 9507084
20637880 20637903 1 + 27260156 TC32 viability GTTGGACACGAGACGCTTGCAGG PINK1 ENSG00000158828 0.07063615442538973 [43] [31,30,34,79] 1 hSpCas9 negative selection 9507085
20633830 20633853 1 - 27869803 HPAFII viability after 27 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 1.969460584982066 [124] [546,15,NaN] 9 hSpCas9 negative selection 9531856
20638098 20638121 1 - 27869803 HPAFII viability after 27 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.23982455508809347 [311] [121,152,NaN] -2 hSpCas9 negative selection 9531857
20633830 20633853 1 - 27869803 HPAFII viability after 15 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 0.5415530366244528 [124] [427,50,NaN] 6 hSpCas9 negative selection 9614305
20638098 20638121 1 - 27869803 HPAFII viability after 15 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.20966891670340404 [311] [388,386,NaN] 2 hSpCas9 negative selection 9614306
20633830 20633853 1 - 27869803 ASPC1 viability after 36 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 0.05695559342734746 [479] [467,97,26] 0 hSpCas9 negative selection 9696754
20638098 20638121 1 - 27869803 ASPC1 viability after 36 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.5341826567157286 [860] [342,441,489] 5 hSpCas9 negative selection 9696755
20633830 20633853 1 - 27869803 PATU8988S viability after 35 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -1.1303995815165244 [401] [54,92,NaN] -8 hSpCas9 negative selection 9779203
20638098 20638121 1 - 27869803 PATU8988S viability after 35 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.6083432618012505 [747] [357,560,NaN] 6 hSpCas9 negative selection 9779204
20633830 20633853 1 - 27869803 PATU8988S viability after 31 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 -0.3454104751883606 [401] [152,91,NaN] -4 hSpCas9 negative selection 9861652
20638098 20638121 1 - 27869803 PATU8988S viability after 31 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 0.6171684864995786 [747] [310,643,NaN] 7 hSpCas9 negative selection 9861653
20633830 20633853 1 - 27869803 HPAFII viability after 35 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 1.9109782677081593 [124] [427,23,NaN] 9 hSpCas9 negative selection 9944101
20638098 20638121 1 - 27869803 HPAFII viability after 35 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.043989069503296785 [311] [92,220,NaN] 0 hSpCas9 negative selection 9944102
20633830 20633853 1 - 27869803 HPAFII viability after 31 days GAAAGACTGCCCGGCCGCAAGGG PINK1 ENSG00000158828 2.0535950050919363 [124] [541,17,NaN] 9 hSpCas9 negative selection 10026550
20638098 20638121 1 - 27869803 HPAFII viability after 31 days CCACATCATCTTGATGGCCAAGG PINK1 ENSG00000158828 -0.6012637369383799 [311] [68,165,NaN] -4 hSpCas9 negative selection 10026551
20633856 20633879 1 - 28162770 P31FUJ viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.7254006869868752 [120] [85] -5 hSpCas9 negative selection 10211515
20638043 20638066 1 + 28162770 P31FUJ viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 2.070389327891398 [123] [611] 9 hSpCas9 negative selection 10211516
20637849 20637872 1 + 28162770 P31FUJ viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 0.25858618099457975 [68] [96] 2 hSpCas9 negative selection 10211517
20639948 20639971 1 + 28162770 P31FUJ viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.21399785724925308 [145] [198] 2 hSpCas9 negative selection 10211518
20633578 20633601 1 - 28162770 P31FUJ viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 1.2819806472241042 [343] [982] 9 hSpCas9 negative selection 10211519
20637982 20638005 1 + 28162770 P31FUJ viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 1.064179533342753 [69] [171] 9 hSpCas9 negative selection 10211520
20637998 20638021 1 + 28162770 P31FUJ viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -1.269144051478099 [200] [97] -7 hSpCas9 negative selection 10211521
20633856 20633879 1 - 28162770 TF1 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 NaN [NaN] [48] 1 hSpCas9 negative selection 10380881
20638043 20638066 1 + 28162770 TF1 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 NaN [NaN] [101] 1 hSpCas9 negative selection 10380882
20637849 20637872 1 + 28162770 TF1 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 NaN [NaN] [60] 1 hSpCas9 negative selection 10380883
20639948 20639971 1 + 28162770 TF1 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 NaN [NaN] [198] 1 hSpCas9 negative selection 10380884
20633578 20633601 1 - 28162770 TF1 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 NaN [NaN] [600] 1 hSpCas9 negative selection 10380885
20637982 20638005 1 + 28162770 TF1 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 NaN [NaN] [127] 1 hSpCas9 negative selection 10380886
20637998 20638021 1 + 28162770 TF1 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 NaN [NaN] [166] 1 hSpCas9 negative selection 10380887
20633856 20633879 1 - 28162770 SKM1 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.3195013574928224 [35] [50] -3 hSpCas9 negative selection 10550247
20638043 20638066 1 + 28162770 SKM1 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -0.4500329206350475 [33] [43] -4 hSpCas9 negative selection 10550248
20637849 20637872 1 + 28162770 SKM1 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.7150864941054935 [25] [27] -5 hSpCas9 negative selection 10550249
20639948 20639971 1 + 28162770 SKM1 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.1432328838173179 [41] [81] 1 hSpCas9 negative selection 10550250
20633578 20633601 1 - 28162770 SKM1 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.7398771895861095 [62] [185] 7 hSpCas9 negative selection 10550251
20637982 20638005 1 + 28162770 SKM1 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 2.005817326595314 [19] [141] 9 hSpCas9 negative selection 10550252
20637998 20638021 1 + 28162770 SKM1 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 0.5499670793649524 [33] [87] 5 hSpCas9 negative selection 10550253
20633856 20633879 1 - 28162770 SKM1 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.3195013574928224 [35] [50] -3 hSpCas9 negative selection 10719613
20638043 20638066 1 + 28162770 SKM1 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -0.4500329206350475 [33] [43] -4 hSpCas9 negative selection 10719614
20637849 20637872 1 + 28162770 SKM1 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.7150864941054935 [25] [27] -5 hSpCas9 negative selection 10719615
20639948 20639971 1 + 28162770 SKM1 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.1432328838173179 [41] [81] 1 hSpCas9 negative selection 10719616
20633578 20633601 1 - 28162770 SKM1 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.7398771895861095 [62] [185] 7 hSpCas9 negative selection 10719617
20637982 20638005 1 + 28162770 SKM1 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 2.005817326595314 [19] [141] 9 hSpCas9 negative selection 10719618
20637998 20638021 1 + 28162770 SKM1 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 0.5499670793649524 [33] [87] 5 hSpCas9 negative selection 10719619
20633856 20633879 1 - 28162770 PL21 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.21489788478952376 [135] [50] -1 hSpCas9 negative selection 10888979
20638043 20638066 1 + 28162770 PL21 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -0.9627989566368852 [102] [22] -6 hSpCas9 negative selection 10888980
20637849 20637872 1 + 28162770 PL21 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.6578413806382519 [86] [23] -4 hSpCas9 negative selection 10888981
20639948 20639971 1 + 28162770 PL21 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 -0.012163989223543979 [189] [81] 0 hSpCas9 negative selection 10888982
20633578 20633601 1 - 28162770 PL21 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.3532563282450784 [258] [143] 3 hSpCas9 negative selection 10888983
20637982 20638005 1 + 28162770 PL21 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 -0.13689537278825048 [47] [18] -1 hSpCas9 negative selection 10888984
20637998 20638021 1 + 28162770 PL21 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -1.3234223415676927 [91] [15] -7 hSpCas9 negative selection 10888985
20633856 20633879 1 - 28162770 P31FUJ viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.7254006869868752 [120] [85] -5 hSpCas9 negative selection 11058345
20638043 20638066 1 + 28162770 P31FUJ viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 2.070389327891398 [123] [611] 9 hSpCas9 negative selection 11058346
20637849 20637872 1 + 28162770 P31FUJ viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 0.25858618099457975 [68] [96] 2 hSpCas9 negative selection 11058347
20639948 20639971 1 + 28162770 P31FUJ viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.21399785724925308 [145] [198] 2 hSpCas9 negative selection 11058348
20633578 20633601 1 - 28162770 P31FUJ viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 1.2819806472241042 [343] [982] 9 hSpCas9 negative selection 11058349
20637982 20638005 1 + 28162770 P31FUJ viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 1.064179533342753 [69] [171] 9 hSpCas9 negative selection 11058350
20637998 20638021 1 + 28162770 P31FUJ viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -1.269144051478099 [200] [97] -7 hSpCas9 negative selection 11058351
20633856 20633879 1 - 28162770 OCIAML5 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -1.530138475976635 [63] [39] -7 hSpCas9 negative selection 11227711
20638043 20638066 1 + 28162770 OCIAML5 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -1.151626852722905 [63] [51] -6 hSpCas9 negative selection 11227712
20637849 20637872 1 + 28162770 OCIAML5 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 0.604791104109474 [50] [139] 5 hSpCas9 negative selection 11227713
20639948 20639971 1 + 28162770 OCIAML5 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 -0.779658075335947 [135] [142] -5 hSpCas9 negative selection 11227714
20633578 20633601 1 - 28162770 OCIAML5 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 1.0986525263647842 [133] [517] 8 hSpCas9 negative selection 11227715
20637982 20638005 1 + 28162770 OCIAML5 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 0.06547126894402999 [53] [101] 0 hSpCas9 negative selection 11227716
20637998 20638021 1 + 28162770 OCIAML5 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -0.8693445622958323 [83] [82] -5 hSpCas9 negative selection 11227717
20633856 20633879 1 - 28162770 EOL1 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 0.16245758324871246 [250] [147] 1 hSpCas9 negative selection 11397077
20638043 20638066 1 + 28162770 EOL1 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 0.5064043614238691 [154] [115] 4 hSpCas9 negative selection 11397078
20637849 20637872 1 + 28162770 EOL1 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 0.3196857134116734 [145] [95] 3 hSpCas9 negative selection 11397079
20639948 20639971 1 + 28162770 EOL1 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.5690671169721456 [347] [271] 5 hSpCas9 negative selection 11397080
20633578 20633601 1 - 28162770 EOL1 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 1.2464758664578968 [315] [394] 9 hSpCas9 negative selection 11397081
20637982 20638005 1 + 28162770 EOL1 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 -0.35229243378828956 [62] [25] -3 hSpCas9 negative selection 11397082
20637998 20638021 1 + 28162770 EOL1 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -0.38956081885752847 [183] [73] -3 hSpCas9 negative selection 11397083
20633856 20633879 1 - 28162770 MOLM13 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 0.2614385040771525 [179] [155] 2 hSpCas9 negative selection 11566443
20638043 20638066 1 + 28162770 MOLM13 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 0.7618805999288183 [145] [178] 6 hSpCas9 negative selection 11566444
20637849 20637872 1 + 28162770 MOLM13 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 0.8330219749971088 [124] [160] 6 hSpCas9 negative selection 11566445
20639948 20639971 1 + 28162770 MOLM13 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.41990935264275725 [213] [206] 3 hSpCas9 negative selection 11566446
20633578 20633601 1 - 28162770 MOLM13 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 -0.41067249100544545 [352] [191] -2 hSpCas9 negative selection 11566447
20637982 20638005 1 + 28162770 MOLM13 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 0.21205047711498892 [79] [66] 1 hSpCas9 negative selection 11566448
20637998 20638021 1 + 28162770 MOLM13 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -0.3577149129678827 [178] [100] -2 hSpCas9 negative selection 11566449
20633856 20633879 1 - 28162770 HEL viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -1.2291048165089609 [182] [49] -6 hSpCas9 negative selection 11735809
20638043 20638066 1 + 28162770 HEL viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -0.002344661158369954 [146] [93] 0 hSpCas9 negative selection 11735810
20637849 20637872 1 + 28162770 HEL viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 0.9906621354206637 [87] [111] 8 hSpCas9 negative selection 11735811
20639948 20639971 1 + 28162770 HEL viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 -0.4838946065306603 [237] [108] -3 hSpCas9 negative selection 11735812
20633578 20633601 1 - 28162770 HEL viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.28309957138060415 [280] [218] 2 hSpCas9 negative selection 11735813
20637982 20638005 1 + 28162770 HEL viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 -0.35726116799964314 [103] [51] -3 hSpCas9 negative selection 11735814
20637998 20638021 1 + 28162770 HEL viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -1.3488489281834428 [170] [42] -7 hSpCas9 negative selection 11735815
20633856 20633879 1 - 28162770 MV411 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -0.34209767972820515 [157] [104] -3 hSpCas9 negative selection 11905175
20638043 20638066 1 + 28162770 MV411 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 0.39263546632271096 [84] [93] 3 hSpCas9 negative selection 11905176
20637849 20637872 1 + 28162770 MV411 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.20186985058081452 [70] [51] -1 hSpCas9 negative selection 11905177
20639948 20639971 1 + 28162770 MV411 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 -0.4682594266297795 [201] [122] -3 hSpCas9 negative selection 11905178
20633578 20633601 1 - 28162770 MV411 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 -0.026595854000275754 [236] [195] 0 hSpCas9 negative selection 11905179
20637982 20638005 1 + 28162770 MV411 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 -0.650682835198011 [81] [43] -4 hSpCas9 negative selection 11905180
20637998 20638021 1 + 28162770 MV411 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -0.5469783155673307 [110] [63] -4 hSpCas9 negative selection 11905181
20633856 20633879 1 - 28162770 MONOMAC1 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 -1.0997396457046387 [85] [45] -7 hSpCas9 negative selection 12074541
20638043 20638066 1 + 28162770 MONOMAC1 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 -1.2208835890139214 [60] [29] -7 hSpCas9 negative selection 12074542
20637849 20637872 1 + 28162770 MONOMAC1 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 0.04397125244424127 [54] [64] 0 hSpCas9 negative selection 12074543
20639948 20639971 1 + 28162770 MONOMAC1 viability GAGCCGAGTGGCCTTGGCTGGGG PINK1 ENSG00000158828 0.2272191822486688 [116] [156] 2 hSpCas9 negative selection 12074544
20633578 20633601 1 - 28162770 MONOMAC1 viability GCAGCGCTCGACCCAGCTGCAGG PINK1 ENSG00000158828 0.5466233996806606 [128] [215] 5 hSpCas9 negative selection 12074545
20637982 20638005 1 + 28162770 MONOMAC1 viability TACATTGCCCCAGAACCTGGAGG PINK1 ENSG00000158828 1.145355350387524 [27] [70] 8 hSpCas9 negative selection 12074546
20637998 20638021 1 + 28162770 MONOMAC1 viability CTGGAGGTGACAAAGAGCACCGG PINK1 ENSG00000158828 -0.24434256183791025 [61] [59] -2 hSpCas9 negative selection 12074547
20633856 20633879 1 - 28162770 OCIAML2 viability GAGGCCCAGCCCTAGCCCGAAGG PINK1 ENSG00000158828 0.24881800766601536 [28] [190] 2 hSpCas9 negative selection 12243907
20638043 20638066 1 + 28162770 OCIAML2 viability GGTACCAGTGCACCAGGAGAAGG PINK1 ENSG00000158828 0.294904921120816 [14] [101] 3 hSpCas9 negative selection 12243908
20637849 20637872 1 + 28162770 OCIAML2 viability TTACCCAGAAAAGCAAGCCGGGG PINK1 ENSG00000158828 -0.14870173035479883 [10] [54] -1 hSpCas9 negative selection 12243909