Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 29978
  • Symbol: UBQLN2
  • Description: ubiquilin 2
DataSource: http://genomecrispr.dkfz.de/#!/results/UBQLN2

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
56564751 56564774 X - 26472758 Jiyoye viability GGAGGAACTACTCCCCACGGAGG UBQLN2 ENSG00000188021 -0.3207450730573256 [52] [31] -2 hSpCas9 negative selection 176730
56564341 56564364 X - 26472758 Jiyoye viability AGTTGGTCGAGCTCAAGCCCAGG UBQLN2 ENSG00000188021 0.2551722880608236 [39] [35] 2 hSpCas9 negative selection 176731
56564837 56564860 X - 26472758 Jiyoye viability GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.5694468104047506 [83] [93] 4 hSpCas9 negative selection 176732
56563877 56563900 X + 26472758 Jiyoye viability GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 0.15341878926009012 [61] [51] 1 hSpCas9 negative selection 176733
56563950 56563973 X - 26472758 Jiyoye viability GATGATTTTAGGCTCAGCCGGGG UBQLN2 ENSG00000188021 1.217905030344134 [60] [106] 7 hSpCas9 negative selection 176734
56563984 56564007 X + 26472758 Jiyoye viability GAAGACTCCCAAAGAGAAAGAGG UBQLN2 ENSG00000188021 -0.41998802163191096 [54] [30] -3 hSpCas9 negative selection 176735
56564209 56564232 X + 26472758 Jiyoye viability CACGCAGCCTAGCAATGCCGCGG UBQLN2 ENSG00000188021 0.831928035617929 [110] [148] 6 hSpCas9 negative selection 176736
56564970 56564993 X - 26472758 Jiyoye viability CAGCAGGCTCTGCATGCCTGGGG UBQLN2 ENSG00000188021 -3.107397791323885 [79] [6] -9 hSpCas9 negative selection 176737
56565281 56565304 X - 26472758 Jiyoye viability GTGAAGCTCGGAATCAGGCCAGG UBQLN2 ENSG00000188021 0.5119715715174833 [145] [156] 4 hSpCas9 negative selection 176738
56565471 56565494 X - 26472758 Jiyoye viability GCTGGACACAGTAGGCCCCGTGG UBQLN2 ENSG00000188021 0.4537179674429037 [60] [62] 3 hSpCas9 negative selection 176739
56564751 56564774 X - 26472758 KBM7 viability GGAGGAACTACTCCCCACGGAGG UBQLN2 ENSG00000188021 0.17529492485690978 [135,73] [47,59] 1 hSpCas9 negative selection 367848
56564341 56564364 X - 26472758 KBM7 viability AGTTGGTCGAGCTCAAGCCCAGG UBQLN2 ENSG00000188021 0.16589294779995656 [344,158] [51,196] 1 hSpCas9 negative selection 367849
56564837 56564860 X - 26472758 KBM7 viability GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.54950494806938 [393,183] [164,216] 6 hSpCas9 negative selection 367850
56563877 56563900 X + 26472758 KBM7 viability GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 -0.47548772830454467 [349,224] [75,112] -4 hSpCas9 negative selection 367851
56563950 56563973 X - 26472758 KBM7 viability GATGATTTTAGGCTCAGCCGGGG UBQLN2 ENSG00000188021 0.3018845104470278 [573,350] [285,241] 3 hSpCas9 negative selection 367852
56563984 56564007 X + 26472758 KBM7 viability GAAGACTCCCAAAGAGAAAGAGG UBQLN2 ENSG00000188021 -0.33817203605927904 [195,176] [43,91] -3 hSpCas9 negative selection 367853
56564209 56564232 X + 26472758 KBM7 viability CACGCAGCCTAGCAATGCCGCGG UBQLN2 ENSG00000188021 0.35686693813189274 [523,502] [308,310] 4 hSpCas9 negative selection 367854
56564970 56564993 X - 26472758 KBM7 viability CAGCAGGCTCTGCATGCCTGGGG UBQLN2 ENSG00000188021 0.2954124184907143 [98,77] [46,53] 3 hSpCas9 negative selection 367855
56565281 56565304 X - 26472758 KBM7 viability GTGAAGCTCGGAATCAGGCCAGG UBQLN2 ENSG00000188021 0.1850812765284694 [808,616] [495,271] 2 hSpCas9 negative selection 367856
56565471 56565494 X - 26472758 KBM7 viability GCTGGACACAGTAGGCCCCGTGG UBQLN2 ENSG00000188021 0.3887728235694119 [302,215] [208,111] 4 hSpCas9 negative selection 367857
56564751 56564774 X - 26472758 Raji viability GGAGGAACTACTCCCCACGGAGG UBQLN2 ENSG00000188021 -0.3607653003648068 [82] [14] -3 hSpCas9 negative selection 558966
56564341 56564364 X - 26472758 Raji viability AGTTGGTCGAGCTCAAGCCCAGG UBQLN2 ENSG00000188021 -0.3706637614310446 [116] [20] -3 hSpCas9 negative selection 558967
56564837 56564860 X - 26472758 Raji viability GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 1.568017901092554 [108] [74] 9 hSpCas9 negative selection 558968
56563877 56563900 X + 26472758 Raji viability GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 -0.2676558959733253 [82] [15] -2 hSpCas9 negative selection 558969
56563950 56563973 X - 26472758 Raji viability GATGATTTTAGGCTCAGCCGGGG UBQLN2 ENSG00000188021 0.25111901283504895 [209] [57] 2 hSpCas9 negative selection 558970
56563984 56564007 X + 26472758 Raji viability GAAGACTCCCAAAGAGAAAGAGG UBQLN2 ENSG00000188021 5.158009608443567 [6] [57] 9 hSpCas9 negative selection 558971
56564209 56564232 X + 26472758 Raji viability CACGCAGCCTAGCAATGCCGCGG UBQLN2 ENSG00000188021 1.4586451242191285 [184] [117] 9 hSpCas9 negative selection 558972
56564970 56564993 X - 26472758 Raji viability CAGCAGGCTCTGCATGCCTGGGG UBQLN2 ENSG00000188021 0.6219567082033579 [125] [44] 6 hSpCas9 negative selection 558973
56565281 56565304 X - 26472758 Raji viability GTGAAGCTCGGAATCAGGCCAGG UBQLN2 ENSG00000188021 -0.1342772196676273 [401] [84] -1 hSpCas9 negative selection 558974
56565471 56565494 X - 26472758 Raji viability GCTGGACACAGTAGGCCCCGTGG UBQLN2 ENSG00000188021 0.8067240572398884 [100] [40] 7 hSpCas9 negative selection 558975
56564751 56564774 X - 26472758 K562 viability GGAGGAACTACTCCCCACGGAGG UBQLN2 ENSG00000188021 0.9568421375698617 [82] [135] 7 hSpCas9 negative selection 750084
56564341 56564364 X - 26472758 K562 viability AGTTGGTCGAGCTCAAGCCCAGG UBQLN2 ENSG00000188021 0.27256976798059596 [202] [206] 2 hSpCas9 negative selection 750085
56564837 56564860 X - 26472758 K562 viability GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.37070792516376405 [316] [345] 3 hSpCas9 negative selection 750086
56563877 56563900 X + 26472758 K562 viability GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 0.5358815418267582 [200] [245] 4 hSpCas9 negative selection 750087
56563950 56563973 X - 26472758 K562 viability GATGATTTTAGGCTCAGCCGGGG UBQLN2 ENSG00000188021 0.8175210731775419 [284] [423] 6 hSpCas9 negative selection 750088
56563984 56564007 X + 26472758 K562 viability GAAGACTCCCAAAGAGAAAGAGG UBQLN2 ENSG00000188021 0.0379678501990206 [119] [103] 0 hSpCas9 negative selection 750089
56564209 56564232 X + 26472758 K562 viability CACGCAGCCTAGCAATGCCGCGG UBQLN2 ENSG00000188021 0.8718859569021385 [300] [464] 7 hSpCas9 negative selection 750090
56564970 56564993 X - 26472758 K562 viability CAGCAGGCTCTGCATGCCTGGGG UBQLN2 ENSG00000188021 -0.6761468048391484 [158] [83] -4 hSpCas9 negative selection 750091
56565281 56565304 X - 26472758 K562 viability GTGAAGCTCGGAATCAGGCCAGG UBQLN2 ENSG00000188021 1.2857821013178723 [360] [742] 9 hSpCas9 negative selection 750092
56565471 56565494 X - 26472758 K562 viability GCTGGACACAGTAGGCCCCGTGG UBQLN2 ENSG00000188021 -0.44070793498014127 [163] [101] -3 hSpCas9 negative selection 750093
56564210 56564233 X + 26627737 DLD1 viability ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 0.5938377475286589 [273] [128,118,137] 6 hSpCas9 negative selection 846148
56564226 56564249 X - 26627737 DLD1 viability CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.2314250524235566 [1288] [634,404,388] 2 hSpCas9 negative selection 846149
56564244 56564267 X - 26627737 DLD1 viability ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 -0.5173008651692222 [265] [100,28,44] -5 hSpCas9 negative selection 846150
56564323 56564346 X + 26627737 DLD1 viability ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.3391500986512975 [443] [195,236,106] 3 hSpCas9 negative selection 846151
56564837 56564860 X - 26627737 DLD1 viability GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.07102006166114466 [534] [176,127,213] 0 hSpCas9 negative selection 846152
56565408 56565431 X - 26627737 DLD1 viability AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 -1.6871146734049707 [64] [6,11,0] -8 hSpCas9 negative selection 846153
56564210 56564233 X + 26627737 GBM cells viability after 5 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.0838827565524478 [105] [96,143] 9 hSpCas9 negative selection 928463
56564226 56564249 X - 26627737 GBM cells viability after 5 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.405360355437802 [730] [307,283] -6 hSpCas9 negative selection 928464
56564244 56564267 X - 26627737 GBM cells viability after 5 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.269557254806076 [197] [121,133] 4 hSpCas9 negative selection 928465
56564323 56564346 X + 26627737 GBM cells viability after 5 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.1237289584889891 [254] [151,145] 2 hSpCas9 negative selection 928466
56564837 56564860 X - 26627737 GBM cells viability after 5 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 -0.7843013335029116 [280] [94,79] -8 hSpCas9 negative selection 928467
56565408 56565431 X - 26627737 GBM cells viability after 5 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 -0.47305490250127247 [65] [19,30] -6 hSpCas9 negative selection 928468
56564210 56564233 X + 26627737 GBM cells viability after 13 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.4099055432127898 [105] [218,98] 9 hSpCas9 negative selection 1010778
56564226 56564249 X - 26627737 GBM cells viability after 13 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.26964845568059825 [730] [344,315] -3 hSpCas9 negative selection 1010779
56564244 56564267 X - 26627737 GBM cells viability after 13 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.4249533772129562 [197] [189,106] 5 hSpCas9 negative selection 1010780
56564323 56564346 X + 26627737 GBM cells viability after 13 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.6146189608376688 [254] [250,179] 7 hSpCas9 negative selection 1010781
56564837 56564860 X - 26627737 GBM cells viability after 13 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 -0.42680316896867543 [280] [124,103] -5 hSpCas9 negative selection 1010782
56565408 56565431 X - 26627737 GBM cells viability after 13 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 0.1203886424650531 [65] [28,46] 1 hSpCas9 negative selection 1010783
56564210 56564233 X + 26627737 GBM cells viability after 21 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 0.22675167873065716 [105] [69,64] 2 hSpCas9 negative selection 1093093
56564226 56564249 X - 26627737 GBM cells viability after 21 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.33560999159930915 [730] [344,286] -3 hSpCas9 negative selection 1093094
56564244 56564267 X - 26627737 GBM cells viability after 21 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 -0.012458319077432056 [197] [114,98] 0 hSpCas9 negative selection 1093095
56564323 56564346 X + 26627737 GBM cells viability after 21 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.264198805537337 [254] [180,152] 2 hSpCas9 negative selection 1093096
56564837 56564860 X - 26627737 GBM cells viability after 21 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 -0.9947112805335999 [280] [73,78] -7 hSpCas9 negative selection 1093097
56565408 56565431 X - 26627737 GBM cells viability after 21 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 -0.23237272099661355 [65] [29,30] -2 hSpCas9 negative selection 1093098
56564210 56564233 X + 26627737 RPE1 viability after 9 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 -1.8739159024852639 [976] [58,114] -8 hSpCas9 negative selection 1175408
56564226 56564249 X - 26627737 RPE1 viability after 9 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.64454963515019 [1827] [929,848] 4 hSpCas9 negative selection 1175409
56564244 56564267 X - 26627737 RPE1 viability after 9 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.4467742220753683 [333] [183,88] 3 hSpCas9 negative selection 1175410
56564323 56564346 X + 26627737 RPE1 viability after 9 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 -0.43878630257692414 [962] [276,151] -3 hSpCas9 negative selection 1175411
56564837 56564860 X - 26627737 RPE1 viability after 9 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.27937686698436626 [750] [242,339] 2 hSpCas9 negative selection 1175412
56565408 56565431 X - 26627737 RPE1 viability after 9 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 1.7702731179214495 [50] [36,76] 8 hSpCas9 negative selection 1175413
56564210 56564233 X + 26627737 RPE1 viability after 12 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 -2.1312752111436213 [976] [5,116] -8 hSpCas9 negative selection 1257723
56564226 56564249 X - 26627737 RPE1 viability after 12 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.4630730801900651 [1827] [863,478] 3 hSpCas9 negative selection 1257724
56564244 56564267 X - 26627737 RPE1 viability after 12 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.5335060710719669 [333] [193,61] 3 hSpCas9 negative selection 1257725
56564323 56564346 X + 26627737 RPE1 viability after 12 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 -0.9516543740032752 [962] [227,33] -6 hSpCas9 negative selection 1257726
56564837 56564860 X - 26627737 RPE1 viability after 12 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.23843325975390164 [750] [221,254] 1 hSpCas9 negative selection 1257727
56565408 56565431 X - 26627737 RPE1 viability after 12 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 0.3038564183856258 [50] [13,19] 2 hSpCas9 negative selection 1257728
56564210 56564233 X + 26627737 RPE1 viability after 15 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 -1.6264313007143956 [976] [144,35] -7 hSpCas9 negative selection 1340038
56564226 56564249 X - 26627737 RPE1 viability after 15 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.5324271501802886 [1827] [1033,471] 3 hSpCas9 negative selection 1340039
56564244 56564267 X - 26627737 RPE1 viability after 15 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 1.0438006134611848 [333] [262,128] 6 hSpCas9 negative selection 1340040
56564323 56564346 X + 26627737 RPE1 viability after 15 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 -0.8490999762694903 [962] [222,81] -5 hSpCas9 negative selection 1340041
56564837 56564860 X - 26627737 RPE1 viability after 15 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.06312802651373113 [750] [196,245] 0 hSpCas9 negative selection 1340042
56565408 56565431 X - 26627737 RPE1 viability after 15 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 0.516397263134706 [50] [12,27] 3 hSpCas9 negative selection 1340043
56564210 56564233 X + 26627737 RPE1 viability after 18 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 -1.9974273740886608 [976] [66,64] -8 hSpCas9 negative selection 1422353
56564226 56564249 X - 26627737 RPE1 viability after 18 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.6834492676455335 [1827] [930,643] 4 hSpCas9 negative selection 1422354
56564244 56564267 X - 26627737 RPE1 viability after 18 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 1.2053842875541332 [333] [290,118] 7 hSpCas9 negative selection 1422355
56564323 56564346 X + 26627737 RPE1 viability after 18 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 -1.2774478293608706 [962] [156,53] -7 hSpCas9 negative selection 1422356
56564837 56564860 X - 26627737 RPE1 viability after 18 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.3197765181618628 [750] [280,222] 2 hSpCas9 negative selection 1422357
56565408 56565431 X - 26627737 RPE1 viability after 18 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 0.42281035876934503 [50] [16,19] 2 hSpCas9 negative selection 1422358
56564210 56564233 X + 26627737 HeLa viability after 8 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.0828264233198652 [127] [177,157,36] 8 hSpCas9 negative selection 1504668
56564226 56564249 X - 26627737 HeLa viability after 8 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.33548845794713245 [794] [518,569,251] 3 hSpCas9 negative selection 1504669
56564244 56564267 X - 26627737 HeLa viability after 8 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 1.5867494630153813 [107] [82,220,108] 9 hSpCas9 negative selection 1504670
56564323 56564346 X + 26627737 HeLa viability after 8 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.6541812871761724 [244] [355,172,25] 5 hSpCas9 negative selection 1504671
56564837 56564860 X - 26627737 HeLa viability after 8 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.745956842495875 [268] [213,214,165] 6 hSpCas9 negative selection 1504672
56565408 56565431 X - 26627737 HeLa viability after 8 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 0.9224729357949233 [38] [94,7,8] 7 hSpCas9 negative selection 1504673
56564210 56564233 X + 26627737 HeLa viability after 12 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.5443256724697836 [127] [104,129,228] 9 hSpCas9 negative selection 1586983
56564226 56564249 X - 26627737 HeLa viability after 12 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.2800520384042873 [794] [437,162,226] -2 hSpCas9 negative selection 1586984
56564244 56564267 X - 26627737 HeLa viability after 12 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 1.955014645261653 [107] [169,116,237] 9 hSpCas9 negative selection 1586985
56564323 56564346 X + 26627737 HeLa viability after 12 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.6998681095538376 [244] [128,233,121] 5 hSpCas9 negative selection 1586986
56564837 56564860 X - 26627737 HeLa viability after 12 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.7715197808772857 [268] [276,93,210] 6 hSpCas9 negative selection 1586987
56565408 56565431 X - 26627737 HeLa viability after 12 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 0.5103010303108251 [38] [12,18,36] 4 hSpCas9 negative selection 1586988
56564210 56564233 X + 26627737 HeLa viability after 15 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 0.9551036145863468 [127] [139,152,1] 7 hSpCas9 negative selection 1669298
56564226 56564249 X - 26627737 HeLa viability after 15 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.05628961651966624 [794] [179,308,537] 0 hSpCas9 negative selection 1669299
56564244 56564267 X - 26627737 HeLa viability after 15 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 1.4512613106926875 [107] [172,102,80] 8 hSpCas9 negative selection 1669300
56564323 56564346 X + 26627737 HeLa viability after 15 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 1.6361822663718242 [244] [456,211,254] 9 hSpCas9 negative selection 1669301
56564837 56564860 X - 26627737 HeLa viability after 15 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.5245649332792132 [268] [188,139,141] 4 hSpCas9 negative selection 1669302
56565408 56565431 X - 26627737 HeLa viability after 15 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 -1.3962048583486286 [38] [0,0,16] -8 hSpCas9 negative selection 1669303
56564210 56564233 X + 26627737 HeLa viability after 18 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 0.9485856970807988 [127] [95,122,1] 7 hSpCas9 negative selection 1751613
56564226 56564249 X - 26627737 HeLa viability after 18 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.08452614444642959 [794] [127,262,537] 0 hSpCas9 negative selection 1751614
56564244 56564267 X - 26627737 HeLa viability after 18 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 1.3965236119566218 [107] [109,81,80] 8 hSpCas9 negative selection 1751615
56564323 56564346 X + 26627737 HeLa viability after 18 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 1.6070259817690897 [244] [298,169,254] 9 hSpCas9 negative selection 1751616
56564837 56564860 X - 26627737 HeLa viability after 18 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.5656340143057713 [268] [133,117,141] 4 hSpCas9 negative selection 1751617
56565408 56565431 X - 26627737 HeLa viability after 18 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 -1.339943375592597 [38] [0,0,16] -8 hSpCas9 negative selection 1751618
56564210 56564233 X + 26627737 HCT116 viability after 6 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.7235949842462133 [223] [56,148] 8 hSpCas9 negative selection 1833928
56564226 56564249 X - 26627737 HCT116 viability after 6 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.1928010795108006 [1687] [321,292] 1 hSpCas9 negative selection 1833929
56564244 56564267 X - 26627737 HCT116 viability after 6 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 -1.0042139243187016 [418] [66,13] -5 hSpCas9 negative selection 1833930
56564323 56564346 X + 26627737 HCT116 viability after 6 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 2.224840131288011 [301] [355,147] 9 hSpCas9 negative selection 1833931
56564837 56564860 X - 26627737 HCT116 viability after 6 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 1.2813056479490386 [622] [190,263] 6 hSpCas9 negative selection 1833932
56565408 56565431 X - 26627737 HCT116 viability after 6 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 -2.3513992133785258 [43] [1,0] -8 hSpCas9 negative selection 1833933
56564210 56564233 X + 26627737 HCT116 viability after 8 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.897747944622083 [61] [87,230,62] 9 hSpCas9 negative selection 1916243
56564226 56564249 X - 26627737 HCT116 viability after 8 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.7783288858405135 [1247] [388,525,288] -7 hSpCas9 negative selection 1916244
56564244 56564267 X - 26627737 HCT116 viability after 8 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.9374922368494617 [168] [218,156,159] 8 hSpCas9 negative selection 1916245
56564323 56564346 X + 26627737 HCT116 viability after 8 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.7237781654356219 [210] [191,270,113] 7 hSpCas9 negative selection 1916246
56564837 56564860 X - 26627737 HCT116 viability after 8 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.88563370961464 [214] [242,270,143] 7 hSpCas9 negative selection 1916247
56565408 56565431 X - 26627737 HCT116 viability after 8 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 5.553054599318321 [0] [35,32,8] 9 hSpCas9 negative selection 1916248
56564210 56564233 X + 26627737 HCT116 viability after 9 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 0.05622679189100421 [223] [26,89] 0 hSpCas9 negative selection 1998558
56564226 56564249 X - 26627737 HCT116 viability after 9 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.037326632263080306 [1687] [299,590] 0 hSpCas9 negative selection 1998559
56564244 56564267 X - 26627737 HCT116 viability after 9 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.5794433882288742 [418] [50,258] 4 hSpCas9 negative selection 1998560
56564323 56564346 X + 26627737 HCT116 viability after 9 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 2.3400931120175965 [301] [247,534] 9 hSpCas9 negative selection 1998561
56564837 56564860 X - 26627737 HCT116 viability after 9 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.8182986711329702 [622] [375,227] 6 hSpCas9 negative selection 1998562
56565408 56565431 X - 26627737 HCT116 viability after 9 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 2.1256087904986973 [43] [0,90] 9 hSpCas9 negative selection 1998563
56564210 56564233 X + 26627737 HCT116 viability after 12 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.7299165183766436 [61] [87,107,129] 9 hSpCas9 negative selection 2080873
56564226 56564249 X - 26627737 HCT116 viability after 12 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.267026623999157 [1247] [436,478,726] -3 hSpCas9 negative selection 2080874
56564244 56564267 X - 26627737 HCT116 viability after 12 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.23769388511223766 [168] [102,132,78] 2 hSpCas9 negative selection 2080875
56564323 56564346 X + 26627737 HCT116 viability after 12 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.8570049321797581 [210] [175,294,135] 7 hSpCas9 negative selection 2080876
56564837 56564860 X - 26627737 HCT116 viability after 12 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.8489137543819252 [214] [161,278,174] 7 hSpCas9 negative selection 2080877
56565408 56565431 X - 26627737 HCT116 viability after 12 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 3.697290138006691 [0] [11,6,0] 9 hSpCas9 negative selection 2080878
56564210 56564233 X + 26627737 HCT116 viability after 15 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 1.4572625449366183 [61] [27,173,82] 9 hSpCas9 negative selection 2163188
56564226 56564249 X - 26627737 HCT116 viability after 15 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.3803330689304485 [1247] [534,565,548] -4 hSpCas9 negative selection 2163189
56564244 56564267 X - 26627737 HCT116 viability after 15 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.9887872998907716 [168] [158,77,334] 8 hSpCas9 negative selection 2163190
56564323 56564346 X + 26627737 HCT116 viability after 15 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.9858753649202183 [210] [235,285,197] 8 hSpCas9 negative selection 2163191
56564837 56564860 X - 26627737 HCT116 viability after 15 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.6826938575413015 [214] [166,326,97] 6 hSpCas9 negative selection 2163192
56565408 56565431 X - 26627737 HCT116 viability after 15 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 5.739661536324351 [0] [61,13,19] 9 hSpCas9 negative selection 2163193
56564210 56564233 X + 26627737 HCT116 viability after 18 days ACGCAGCCTAGCAATGCCGCGGG UBQLN2 ENSG00000188021 2.5025067704580826 [61] [186,218,96] 9 hSpCas9 negative selection 2245503
56564226 56564249 X - 26627737 HCT116 viability after 18 days CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.17134398293650177 [1247] [419,474,724] -1 hSpCas9 negative selection 2245504
56564244 56564267 X - 26627737 HCT116 viability after 18 days ACTCCTGGGAGTCGACGCCGAGG UBQLN2 ENSG00000188021 0.5404064040045952 [168] [89,91,178] 4 hSpCas9 negative selection 2245505
56564323 56564346 X + 26627737 HCT116 viability after 18 days ACTTGCAGGCCTTAGCAGCCTGG UBQLN2 ENSG00000188021 0.5862082902820881 [210] [187,133,137] 5 hSpCas9 negative selection 2245506
56564837 56564860 X - 26627737 HCT116 viability after 18 days GAACTCTGGGTAGCTGGCGGTGG UBQLN2 ENSG00000188021 0.6440802139584328 [214] [215,202,60] 5 hSpCas9 negative selection 2245507
56565408 56565431 X - 26627737 HCT116 viability after 18 days AGTGGGTCCTATGGGCCCAATGG UBQLN2 ENSG00000188021 4.766511520551987 [0] [10,0,28] 9 hSpCas9 negative selection 2245508
56563865 56563888 X + 24336569 HL60 viability GCGGCCGCCATGGCTGAGAATGG UBQLN2 ENSG00000188021 0.414364805857407 [305] [862] 4 hSpCas9 negative selection 2304880
56563872 56563895 X - 24336569 HL60 viability GCTCTCGCCATTCTCAGCCATGG UBQLN2 ENSG00000188021 -0.005113214498781493 [505] [1066] 0 hSpCas9 negative selection 2304881
56563877 56563900 X + 24336569 HL60 viability GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 0.7202516153918382 [768] [2680] 6 hSpCas9 negative selection 2304882
56563915 56563938 X - 24336569 HL60 viability CTTGGGCCGCAGCAGGGCCGCGG UBQLN2 ENSG00000188021 -0.23711497108909052 [175] [315] -2 hSpCas9 negative selection 2304883
56563921 56563944 X - 24336569 HL60 viability CCGAGCCTTGGGCCGCAGCAGGG UBQLN2 ENSG00000188021 0.7289259453550617 [813] [2854] 6 hSpCas9 negative selection 2304884
56563984 56564007 X + 24336569 HL60 viability GAAGACTCCCAAAGAGAAAGAGG UBQLN2 ENSG00000188021 0.34464163560614747 [210] [566] 3 hSpCas9 negative selection 2304885
56563991 56564014 X - 24336569 HL60 viability GCGAACTCCTCTTTCTCTTTGGG UBQLN2 ENSG00000188021 0.5845968253864982 [391] [1243] 5 hSpCas9 negative selection 2304886
56564011 56564034 X + 24336569 HL60 viability CGCGGTGCCCGAGAACAGCTCGG UBQLN2 ENSG00000188021 1.0500956036043814 [198] [871] 7 hSpCas9 negative selection 2304887
56564018 56564041 X - 24336569 HL60 viability TGCTGAACCGAGCTGTTCTCGGG UBQLN2 ENSG00000188021 0.6691922563133679 [429] [1446] 6 hSpCas9 negative selection 2304888
56564026 56564049 X + 24336569 HL60 viability CAGCTCGGTTCAGCAGTTTAAGG UBQLN2 ENSG00000188021 1.1334483555867263 [220] [1025] 8 hSpCas9 negative selection 2304889
56563865 56563888 X + 24336569 KBM7 viability GCGGCCGCCATGGCTGAGAATGG UBQLN2 ENSG00000188021 0.4873257752292326 [135] [519] 4 hSpCas9 negative selection 2372057
56563872 56563895 X - 24336569 KBM7 viability GCTCTCGCCATTCTCAGCCATGG UBQLN2 ENSG00000188021 -0.8803186975611852 [327] [485] -6 hSpCas9 negative selection 2372058
56563877 56563900 X + 24336569 KBM7 viability GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 -1.037891322631081 [742] [986] -6 hSpCas9 negative selection 2372059
56563915 56563938 X - 24336569 KBM7 viability CTTGGGCCGCAGCAGGGCCGCGG UBQLN2 ENSG00000188021 0.13326719570004175 [116] [349] 1 hSpCas9 negative selection 2372060
56563921 56563944 X - 24336569 KBM7 viability CCGAGCCTTGGGCCGCAGCAGGG UBQLN2 ENSG00000188021 0.8364021477298231 [546] [2663] 7 hSpCas9 negative selection 2372061
56563984 56564007 X + 24336569 KBM7 viability GAAGACTCCCAAAGAGAAAGAGG UBQLN2 ENSG00000188021 0.9826273503345899 [135] [732] 8 hSpCas9 negative selection 2372062
56563991 56564014 X - 24336569 KBM7 viability GCGAACTCCTCTTTCTCTTTGGG UBQLN2 ENSG00000188021 -0.4155179873165842 [622] [1273] -3 hSpCas9 negative selection 2372063
56564011 56564034 X + 24336569 KBM7 viability CGCGGTGCCCGAGAACAGCTCGG UBQLN2 ENSG00000188021 1.0986137340076982 [219] [1284] 8 hSpCas9 negative selection 2372064
56564018 56564041 X - 24336569 KBM7 viability TGCTGAACCGAGCTGTTCTCGGG UBQLN2 ENSG00000188021 1.0863306380476911 [301] [1748] 8 hSpCas9 negative selection 2372065
56564026 56564049 X + 24336569 KBM7 viability CAGCTCGGTTCAGCAGTTTAAGG UBQLN2 ENSG00000188021 0.8222443749475505 [264] [1277] 7 hSpCas9 negative selection 2372066
56564754 56564777 X - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity AGAGGAGGAACTACTCCCCACGG UBQLN2 ENSG00000188021 0.320498433629296 [3,3] [3,3] 6 hSpCas9 positive selection 3030687
56564226 56564249 X - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.1624737344251498 [3,3] [4,3] 3 hSpCas9 positive selection 3030688
56563878 56563901 X + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 -0.5385604391104833 [3,2] [1,1] -7 hSpCas9 positive selection 3030689
56564740 56564763 X + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GTAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.3065267823718022 [4,4] [3,5] 6 hSpCas9 positive selection 3030690
56564754 56564777 X - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity AGAGGAGGAACTACTCCCCACGG UBQLN2 ENSG00000188021 -0.49466848613052433 [3,3] [2,0] -7 hSpCas9 positive selection 3098545
56564226 56564249 X - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.08995608240636145 [3,3] [3,2] 1 hSpCas9 positive selection 3098546
56563878 56563901 X + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 0.3895196065542172 [3,3] [2,3] 6 hSpCas9 positive selection 3098547
56564740 56564763 X + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GTAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 -0.1286382217078396 [4,4] [4,1] -2 hSpCas9 positive selection 3098548
56564714 56564737 + 24336571 A375 resistance to PLX after 7 days AATGCCGCACAAGAGCAGTTTGG UBQLN2 ENSG00000188021 -0.19000122563663457 [6,4] [3,5] -6 hSpCas9 positive selection 3154065
56564457 56564480 + 24336571 A375 resistance to PLX after 7 days TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.05901312450642604 [5,4] [4,4] 2 hSpCas9 positive selection 3154066
56564714 56564737 + 24336571 A375 resistance to PLX after 14 days AATGCCGCACAAGAGCAGTTTGG UBQLN2 ENSG00000188021 -0.47118464838872187 [11,3] [2,1] -5 hSpCas9 positive selection 3211858
56564457 56564480 + 24336571 A375 resistance to PLX after 14 days TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.23195086888380634 [2,3] [1,1] 2 hSpCas9 positive selection 3211859
56564714 56564737 + 24336571 A375 viability after 7 days AATGCCGCACAAGAGCAGTTTGG UBQLN2 ENSG00000188021 0.05616371303281187 [5] [6,4] 0 hSpCas9 negative selection 3269651
56564457 56564480 + 24336571 A375 viability after 7 days TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 -0.21668411285787847 [5] [5,4] -3 hSpCas9 negative selection 3269652
56564714 56564737 + 24336571 A375 viability after 14 days AATGCCGCACAAGAGCAGTTTGG UBQLN2 ENSG00000188021 0.5053400521534321 [5] [11,3] 6 hSpCas9 negative selection 3327444
56564457 56564480 + 24336571 A375 viability after 14 days TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 -0.659064634018601 [5] [2,3] -7 hSpCas9 negative selection 3327445
56564283 56564306 X - 27383988 293T resistance to West Nile virus (flavivirus) CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.3265888738829487 [121,121] [0,0] 1 hSpCas9 positive selection 3400118
56564657 56564680 X - 27383988 293T resistance to West Nile virus (flavivirus) CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -1.4150991305256606 [407,407] [0,0] -8 hSpCas9 positive selection 3400119
56564203 56564226 X - 27383988 293T resistance to West Nile virus (flavivirus) CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 0.08740121000352279 [143,143] [0,0] 0 hSpCas9 positive selection 3400120
56564754 56564777 X - 26780180 HT29 viability (Avana library 4 designs) AGAGGAGGAACTACTCCCCACGG UBQLN2 ENSG00000188021 1.06301620262 [] [] 4 hSpCas9 negative selection 3469624
56564226 56564249 X - 26780180 HT29 viability (Avana library 4 designs) CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.709453646416968 [] [] 2 hSpCas9 negative selection 3469625
56563877 56563900 X + 26780180 HT29 viability (Avana library 4 designs) GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 0.714545070263582 [] [] 2 hSpCas9 negative selection 3469626
56564739 56564762 X + 26780180 HT29 viability (Avana library 4 designs) GTAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.322320782502823 [] [] 1 hSpCas9 negative selection 3469627
56563877 56563900 X + 26780180 A375 viability (Avana lentiCRISPRv2) GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 2.51573716457273 [] [] 4 hSpCas9 negative selection 3574945
56564226 56564249 X - 26780180 A375 viability (Avana lentiCRISPRv2) CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 6.27230241141731 [] [] 9 hSpCas9 negative selection 3574946
56564754 56564777 X - 26780180 A375 viability (Avana lentiCRISPRv2) AGAGGAGGAACTACTCCCCACGG UBQLN2 ENSG00000188021 4.12462882819122 [] [] 6 hSpCas9 negative selection 3574947
56564739 56564762 X + 26780180 A375 viability (Avana lentiCRISPRv2) GTAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 2.53326259537215 [] [] 4 hSpCas9 negative selection 3574948
56564258 56564281 X - 26780180 A375 viability (Avana lentiCRISPRv2) ATAGGTGTGGAGTTACTCCTGGG UBQLN2 ENSG00000188021 1.6044201734377 [] [] 2 hSpCas9 negative selection 3574949
56563915 56563938 X - 26780180 A375 viability (Avana lentiCRISPRv2) CTTGGGCCGCAGCAGGGCCGCGG UBQLN2 ENSG00000188021 6.04161818582225 [] [] 9 hSpCas9 negative selection 3574950
56563877 56563900 X + 26780180 A375 viability (Avana lentiGuide) GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 1.97422526786519 [] [] 2 hSpCas9 negative selection 3683604
56564226 56564249 X - 26780180 A375 viability (Avana lentiGuide) CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 1.10407601807452 [] [] 1 hSpCas9 negative selection 3683605
56564754 56564777 X - 26780180 A375 viability (Avana lentiGuide) AGAGGAGGAACTACTCCCCACGG UBQLN2 ENSG00000188021 18.2515121753369 [] [] 8 hSpCas9 negative selection 3683606
56564739 56564762 X + 26780180 A375 viability (Avana lentiGuide) GTAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 -4.96812571994251 [] [] -8 hSpCas9 negative selection 3683607
56564258 56564281 X - 26780180 A375 viability (Avana lentiGuide) ATAGGTGTGGAGTTACTCCTGGG UBQLN2 ENSG00000188021 3.1043988543668 [] [] 3 hSpCas9 negative selection 3683608
56563915 56563938 X - 26780180 A375 viability (Avana lentiGuide) CTTGGGCCGCAGCAGGGCCGCGG UBQLN2 ENSG00000188021 -3.23213393736858 [] [] -5 hSpCas9 negative selection 3683609
56563877 56563900 X + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 0.33269473134791194 [4] [4,5] 8 hSpCas9 positive selection 3792211
56564226 56564249 X - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 0.2711268259717898 [5] [6,5] 7 hSpCas9 positive selection 3792212
56564754 56564777 X - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AGAGGAGGAACTACTCCCCACGG UBQLN2 ENSG00000188021 0.30260440518874876 [4] [5,5] 8 hSpCas9 positive selection 3792213
56564739 56564762 X + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GTAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.1658630549251092 [5] [6,5] 4 hSpCas9 positive selection 3792214
56564258 56564281 X - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ATAGGTGTGGAGTTACTCCTGGG UBQLN2 ENSG00000188021 0.01078939937409168 [6] [6,6] 0 hSpCas9 positive selection 3792215
56563915 56563938 X - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CTTGGGCCGCAGCAGGGCCGCGG UBQLN2 ENSG00000188021 0.3127997904041279 [4] [6,4] 8 hSpCas9 positive selection 3792216
56563877 56563900 X + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCTGAGAATGGCGAGAGCAGCGG UBQLN2 ENSG00000188021 -0.6304751595992466 [4] [2,1] -7 hSpCas9 positive selection 3900818
56564226 56564249 X - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CGAGGTAGTGTTAGTTCCCGCGG UBQLN2 ENSG00000188021 -0.012030755201499738 [6] [4,4] 0 hSpCas9 positive selection 3900819
56564754 56564777 X - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AGAGGAGGAACTACTCCCCACGG UBQLN2 ENSG00000188021 0.06387815685447717 [5] [5,2] 1 hSpCas9 positive selection 3900820
56564739 56564762 X + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GTAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.20695179405096692 [5] [6,5] 5 hSpCas9 positive selection 3900821
56564258 56564281 X - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ATAGGTGTGGAGTTACTCCTGGG UBQLN2 ENSG00000188021 -0.17834705421961253 [6] [4,4] -2 hSpCas9 positive selection 3900822
56563915 56563938 X - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CTTGGGCCGCAGCAGGGCCGCGG UBQLN2 ENSG00000188021 -0.01626390458846673 [5] [2,5] 0 hSpCas9 positive selection 3900823
56564203 56564226 X - 26780180 A375 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 1.70758696149292 [] [] 9 hSpCas9 negative selection 4009924
56564283 56564306 X - 26780180 A375 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.647448965082471 [] [] 2 hSpCas9 negative selection 4009925
56564657 56564680 X - 26780180 A375 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 1.02488165042747 [] [] 5 hSpCas9 negative selection 4009926
56564737 56564760 X + 26780180 A375 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.762792000373562 [] [] 3 hSpCas9 negative selection 4009927
56565489 56565512 X - 26780180 A375 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 1.3091428068075 [] [] 7 hSpCas9 negative selection 4009928
56564457 56564480 X + 26780180 A375 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 1.01448382245069 [] [] 5 hSpCas9 negative selection 4009929
56564203 56564226 X - 26780180 HT29 viability (GeCKOv2 library) CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 1.76389750996021 [] [] 8 hSpCas9 negative selection 4117890
56564283 56564306 X - 26780180 HT29 viability (GeCKOv2 library) CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 1.12272378809623 [] [] 5 hSpCas9 negative selection 4117891
56564657 56564680 X - 26780180 HT29 viability (GeCKOv2 library) CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 1.5201699172706 [] [] 7 hSpCas9 negative selection 4117892
56564737 56564760 X + 26780180 HT29 viability (GeCKOv2 library) GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 1.225089527695 [] [] 6 hSpCas9 negative selection 4117893
56565489 56565512 X - 26780180 HT29 viability (GeCKOv2 library) GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 1.23422740825712 [] [] 6 hSpCas9 negative selection 4117894
56564457 56564480 X + 26780180 HT29 viability (GeCKOv2 library) TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.498476277038281 [] [] 1 hSpCas9 negative selection 4117895
56564714 56564737 X + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) AATGCCGCACAAGAGCAGTTTGG UBQLN2 ENSG00000188021 -0.019903704265748057 [2] [1,0] 0 hSpCas9 positive selection 4180738
56564457 56564480 X + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 -0.721418432805813 [2] [0,0] -9 hSpCas9 positive selection 4180739
56564714 56564737 X + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) AATGCCGCACAAGAGCAGTTTGG UBQLN2 ENSG00000188021 1.6844685796229633 [1] [2,0,3,3] 9 hSpCas9 positive selection 4244760
56564457 56564480 X + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.05600169465758437 [2] [2,1,0,0] 0 hSpCas9 positive selection 4244761
56565489 56565512 X - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.2776422824507634 [1] [0,0] -5 hSpCas9 positive selection 4306353
56564737 56564760 X + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.11496276203251823 [2] [1,1] 2 hSpCas9 positive selection 4306354
56564457 56564480 X + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.30621643784172503 [3] [3,2] 6 hSpCas9 positive selection 4306355
56564283 56564306 X - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.126301278172628 [2] [2,1] 2 hSpCas9 positive selection 4370602
56564657 56564680 X - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.09375938892739605 [4] [3,2] -2 hSpCas9 positive selection 4370603
56564203 56564226 X - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.30489417498411137 [3] [2,1] -6 hSpCas9 positive selection 4370604
56564149 56564171 X - 27760321 OCIAML3 viability GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.7129507163573746 [436,364] [379,683] 8 hSpCas9 negative selection 4451951
56564181 56564203 X + 27760321 OCIAML3 viability AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.36082484045843816 [517,383] [421,483] 4 hSpCas9 negative selection 4451952
56564208 56564230 X - 27760321 OCIAML3 viability GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.7447904008495762 [751,622] [725,1119] 8 hSpCas9 negative selection 4451953
56564465 56564487 X - 27760321 OCIAML3 viability TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.5579439230601669 [614,475] [511,768] 6 hSpCas9 negative selection 4451954
56564740 56564762 X + 27760321 OCIAML3 viability TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.24745115840558662 [844,726] [553,953] 3 hSpCas9 negative selection 4451955
56564149 56564171 X - 27760321 OCIAML2 viability GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.5564009767344401 [436,364] [459,494] 7 hSpCas9 negative selection 4535414
56564181 56564203 X + 27760321 OCIAML2 viability AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.4359031247699667 [517,383] [467,516] 6 hSpCas9 negative selection 4535415
56564208 56564230 X - 27760321 OCIAML2 viability GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.6133779982370898 [751,622] [793,916] 8 hSpCas9 negative selection 4535416
56564465 56564487 X - 27760321 OCIAML2 viability TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.40007437525668843 [614,475] [474,713] 5 hSpCas9 negative selection 4535417
56564740 56564762 X + 27760321 OCIAML2 viability TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.16411119601982727 [844,726] [589,868] 2 hSpCas9 negative selection 4535418
56564149 56564171 X - 27760321 MV411 viability GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 2.1510977348560303 [436,364] [1592,535] 9 hSpCas9 negative selection 4618877
56564181 56564203 X + 27760321 MV411 viability AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 1.5037196107318975 [517,383] [1120,408] 9 hSpCas9 negative selection 4618878
56564208 56564230 X - 27760321 MV411 viability GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 -0.6885095133610407 [751,622] [115,526] -5 hSpCas9 negative selection 4618879
56564465 56564487 X - 27760321 MV411 viability TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 1.3774083153776586 [614,475] [822,1086] 8 hSpCas9 negative selection 4618880
56564740 56564762 X + 27760321 MV411 viability TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.28347338940744227 [844,726] [728,479] 2 hSpCas9 negative selection 4618881
56564149 56564171 X - 27760321 HL60 viability GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 1.182387746963184 [436,364] [835,638] 9 hSpCas9 negative selection 4702340
56564181 56564203 X + 27760321 HL60 viability AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.40660107677823876 [517,383] [483,483] 5 hSpCas9 negative selection 4702341
56564208 56564230 X - 27760321 HL60 viability GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.5069929044264122 [751,622] [895,686] 6 hSpCas9 negative selection 4702342
56564465 56564487 X - 27760321 HL60 viability TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.7129059436117765 [614,475] [663,789] 7 hSpCas9 negative selection 4702343
56564740 56564762 X + 27760321 HL60 viability TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.7791662103622113 [844,726] [1121,1073] 8 hSpCas9 negative selection 4702344
56564149 56564171 X - 27760321 HT1080 viability GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 2.3038286488251325 [364,284] [750,516] 9 hSpCas9 negative selection 4785803
56564181 56564203 X + 27760321 HT1080 viability AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.24310008981170306 [383,299] [250,62] 1 hSpCas9 negative selection 4785804
56564208 56564230 X - 27760321 HT1080 viability GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 1.251007928572733 [622,485] [614,427] 6 hSpCas9 negative selection 4785805
56564465 56564487 X - 27760321 HT1080 viability TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 1.1221360386667711 [475,371] [434,293] 6 hSpCas9 negative selection 4785806
56564740 56564762 X + 27760321 HT1080 viability TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 1.3351875709624266 [726,566] [708,585] 7 hSpCas9 negative selection 4785807
56564149 56564171 X - 27760321 HT29 viability after 7 days GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.7909880130929257 [364,284] [750,538,876] 9 hSpCas9 negative selection 4869266
56564181 56564203 X + 27760321 HT29 viability after 7 days AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.7709030808109846 [383,299] [673,462,1090] 9 hSpCas9 negative selection 4869267
56564208 56564230 X - 27760321 HT29 viability after 7 days GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.40971570255935175 [622,485] [1146,892,831] 6 hSpCas9 negative selection 4869268
56564465 56564487 X - 27760321 HT29 viability after 7 days TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.3305667354892664 [475,371] [799,711,563] 5 hSpCas9 negative selection 4869269
56564740 56564762 X + 27760321 HT29 viability after 7 days TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.07787065150500538 [726,566] [1032,848,775] 1 hSpCas9 negative selection 4869270
56564149 56564171 X - 27760321 HT29 viability after 25 days GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.8185617497476381 [364,284] [727,736,475] 8 hSpCas9 negative selection 4952729
56564181 56564203 X + 27760321 HT29 viability after 25 days AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.5300635579798092 [383,299] [390,560,772] 6 hSpCas9 negative selection 4952730
56564208 56564230 X - 27760321 HT29 viability after 25 days GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.4208371894631956 [622,485] [997,749,778] 4 hSpCas9 negative selection 4952731
56564465 56564487 X - 27760321 HT29 viability after 25 days TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.6079694342140035 [475,371] [524,766,958] 6 hSpCas9 negative selection 4952732
56564740 56564762 X + 27760321 HT29 viability after 25 days TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 -0.09270050953516784 [726,566] [762,597,715] -1 hSpCas9 negative selection 4952733
56564149 56564171 X - 27760321 HT29 viability after 22 days GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.7801490254477413 [364,284] [666,737,528] 8 hSpCas9 negative selection 5036192
56564181 56564203 X + 27760321 HT29 viability after 22 days AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.5825576316543549 [383,299] [570,702,501] 6 hSpCas9 negative selection 5036193
56564208 56564230 X - 27760321 HT29 viability after 22 days GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.3873053344656633 [622,485] [934,799,776] 4 hSpCas9 negative selection 5036194
56564465 56564487 X - 27760321 HT29 viability after 22 days TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.8452208851168702 [475,371] [880,877,882] 8 hSpCas9 negative selection 5036195
56564740 56564762 X + 27760321 HT29 viability after 22 days TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.012848838601455137 [726,566] [770,778,712] 0 hSpCas9 negative selection 5036196
56564149 56564171 X - 27760321 HT29 viability after 19 days GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 1.0304268602764055 [364,284] [1008,604,691] 9 hSpCas9 negative selection 5119655
56564181 56564203 X + 27760321 HT29 viability after 19 days AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.792370073502432 [383,299] [538,735,739] 7 hSpCas9 negative selection 5119656
56564208 56564230 X - 27760321 HT29 viability after 19 days GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.28358123676637703 [622,485] [742,1007,568] 2 hSpCas9 negative selection 5119657
56564465 56564487 X - 27760321 HT29 viability after 19 days TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.677279493919738 [475,371] [835,711,783] 7 hSpCas9 negative selection 5119658
56564740 56564762 X + 27760321 HT29 viability after 19 days TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 -0.24702078180055176 [726,566] [825,220,835] -2 hSpCas9 negative selection 5119659
56564149 56564171 X - 27760321 HT29 viability after 16 days GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.8965072320912607 [364,284] [775,636,627] 9 hSpCas9 negative selection 5203118
56564181 56564203 X + 27760321 HT29 viability after 16 days AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.561012328935327 [383,299] [336,564,769] 6 hSpCas9 negative selection 5203119
56564208 56564230 X - 27760321 HT29 viability after 16 days GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.27413689515264017 [622,485] [896,569,801] 3 hSpCas9 negative selection 5203120
56564465 56564487 X - 27760321 HT29 viability after 16 days TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.8221856712156027 [475,371] [702,778,1022] 8 hSpCas9 negative selection 5203121
56564740 56564762 X + 27760321 HT29 viability after 16 days TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.0199889538513488 [726,566] [926,730,561] 0 hSpCas9 negative selection 5203122
56564149 56564171 X - 27760321 HT29 viability after 13 days GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.6959486472446839 [364,284] [661,607,564] 8 hSpCas9 negative selection 5286581
56564181 56564203 X + 27760321 HT29 viability after 13 days AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.2773228254415085 [383,299] [354,694,397] 3 hSpCas9 negative selection 5286582
56564208 56564230 X - 27760321 HT29 viability after 13 days GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.24445552822622862 [622,485] [834,964,501] 3 hSpCas9 negative selection 5286583
56564465 56564487 X - 27760321 HT29 viability after 13 days TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.32730870991817895 [475,371] [659,805,398] 4 hSpCas9 negative selection 5286584
56564740 56564762 X + 27760321 HT29 viability after 13 days TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 -0.07092626509566169 [726,566] [866,558,716] -1 hSpCas9 negative selection 5286585
56564149 56564171 X - 27760321 HT29 viability after 10 days GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 0.7223743609872321 [364,284] [551,973,494] 8 hSpCas9 negative selection 5370044
56564181 56564203 X + 27760321 HT29 viability after 10 days AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 0.28253442675406254 [383,299] [346,813,407] 4 hSpCas9 negative selection 5370045
56564208 56564230 X - 27760321 HT29 viability after 10 days GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.18010057765087806 [622,485] [809,673,863] 2 hSpCas9 negative selection 5370046
56564465 56564487 X - 27760321 HT29 viability after 10 days TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 0.07760376360953533 [475,371] [583,627,467] 1 hSpCas9 negative selection 5370047
56564740 56564762 X + 27760321 HT29 viability after 10 days TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 -0.2040213517088486 [726,566] [882,666,555] -3 hSpCas9 negative selection 5370048
56564149 56564171 X - 27760321 MOLM13 viability GTGAACAGTCAGCCCATCATGG UBQLN2 ENSG00000188021 1.0264070951259352 [436,364] [593,343] 7 hSpCas9 negative selection 5453507
56564181 56564203 X + 27760321 MOLM13 viability AAAGCCAGAACCGACCTCAGGG UBQLN2 ENSG00000188021 2.010429336664734 [517,383] [826,1176] 9 hSpCas9 negative selection 5453508
56564208 56564230 X - 27760321 MOLM13 viability GCGGCATTGCTAGGCTGCGTGG UBQLN2 ENSG00000188021 0.5304564170198361 [751,622] [627,497] 3 hSpCas9 negative selection 5453509
56564465 56564487 X - 27760321 MOLM13 viability TGAGCTGCCTCATCAGATCGGG UBQLN2 ENSG00000188021 1.0194143400119882 [614,475] [956,331] 7 hSpCas9 negative selection 5453510
56564740 56564762 X + 27760321 MOLM13 viability TAATCCATTTGCCTCCGTGGGG UBQLN2 ENSG00000188021 0.9615956563795155 [844,726] [623,1062] 6 hSpCas9 negative selection 5453511
56563616 56563639 X + 27661255 K562 viability GCGGTCGGATCACAAGGCGGCGG UBQLN2 ENSG00000188021 -0.0347131162882007 [721,873] [678,569] -1 dCas9-KRAB negative selection 5521245
56563619 56563642 X + 27661255 K562 viability GTCGGATCACAAGGCGGCGGCGG UBQLN2 ENSG00000188021 -0.017157880212840197 [852,746] [666,603] 0 dCas9-KRAB negative selection 5521246
56563648 56563671 X - 27661255 K562 viability GTCTCCGCGCTCCGGTCTCTGGG UBQLN2 ENSG00000188021 0.04955843821696326 [915,939] [829,712] 1 dCas9-KRAB negative selection 5521247
56563683 56563706 X - 27661255 K562 viability GTGGAGAAAGGCCTGGGCGTAGG UBQLN2 ENSG00000188021 -0.4497404304316809 [1022,1148] [669,602] -7 dCas9-KRAB negative selection 5521248
56565489 56565512 X - 27260156 BXPC3 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.007440081351204553 [196] [175,240,236,169] 0 hSpCas9 negative selection 5578813
56564737 56564760 X + 27260156 BXPC3 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.2896217289129537 [222] [152,250,197,155] -6 hSpCas9 negative selection 5578814
56564457 56564480 X + 27260156 BXPC3 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.41780416911674634 [501] [705,596,771,735] 8 hSpCas9 negative selection 5578815
56564283 56564306 X - 27260156 BXPC3 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 -0.0338346809974851 [333] [244,390,356,381] 0 hSpCas9 negative selection 5643062
56564657 56564680 X - 27260156 BXPC3 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.4036665675371177 [1095] [739,746,847,1183] -7 hSpCas9 negative selection 5643063
56564203 56564226 X - 27260156 BXPC3 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.3440138535887706 [718] [458,586,616,734] -6 hSpCas9 negative selection 5643064
56565489 56565512 X - 27260156 A673 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.02488294815204961 [196] [264,227,207,265] 0 hSpCas9 negative selection 5700064
56564737 56564760 X + 27260156 A673 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.259432218648997 [222] [243,233,189,228] -6 hSpCas9 negative selection 5700065
56564457 56564480 X + 27260156 A673 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.4467471067252923 [501] [902,710,867,813] 8 hSpCas9 negative selection 5700066
56564283 56564306 X - 27260156 A673 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.31071045641191586 [333] [531,495,481,481] 7 hSpCas9 negative selection 5764313
56564657 56564680 X - 27260156 A673 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.429189562552761 [1095] [1035,1035,1035,793] -8 hSpCas9 negative selection 5764314
56564203 56564226 X - 27260156 A673 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.33505099964562707 [718] [829,618,655,647] -7 hSpCas9 negative selection 5764315
56565489 56565512 X - 27260156 A375 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.09192552061259862 [196] [126,321,352,193] 1 hSpCas9 negative selection 5821315
56564737 56564760 X + 27260156 A375 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.15441589881448226 [222] [437,379,220,149] 2 hSpCas9 negative selection 5821316
56564457 56564480 X + 27260156 A375 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.48632996493334635 [501] [927,955,505,901] 7 hSpCas9 negative selection 5821317
56564283 56564306 X - 27260156 A375 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.5019520617771163 [333] [588,707,476,465] 7 hSpCas9 negative selection 5885564
56564657 56564680 X - 27260156 A375 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.0672879776944546 [1095] [1365,1291,1288,975] -1 hSpCas9 negative selection 5885565
56564203 56564226 X - 27260156 A375 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 0.05270104095300954 [718] [781,873,1373,495] 0 hSpCas9 negative selection 5885566
56565489 56565512 X - 27260156 COLO741 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.18626957372856423 [196] [321,190,162] -4 hSpCas9 negative selection 5942566
56564737 56564760 X + 27260156 COLO741 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.04616781358110389 [222] [190,391,239] -1 hSpCas9 negative selection 5942567
56564457 56564480 X + 27260156 COLO741 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.5033152645812641 [501] [1043,899,800] 8 hSpCas9 negative selection 5942568
56564283 56564306 X - 27260156 COLO741 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.22028914101706637 [333] [447,578,461] 4 hSpCas9 negative selection 6006815
56564657 56564680 X - 27260156 COLO741 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.3421540334688058 [1095] [1106,1283,933] -6 hSpCas9 negative selection 6006816
56564203 56564226 X - 27260156 COLO741 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.6396944597934774 [718] [695,484,594] -8 hSpCas9 negative selection 6006817
56565489 56565512 X - 27260156 CAL120 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.05508737670243358 [196] [524,86,140] -1 hSpCas9 negative selection 6063817
56564737 56564760 X + 27260156 CAL120 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.08464363292563526 [222] [430,149,229] -1 hSpCas9 negative selection 6063818
56564457 56564480 X + 27260156 CAL120 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.04406579233129143 [501] [425,655,813] 0 hSpCas9 negative selection 6063819
56564283 56564306 X - 27260156 CAL120 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.6696514338091736 [333] [1114,643,298] 8 hSpCas9 negative selection 6128066
56564657 56564680 X - 27260156 CAL120 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.272417862947289 [1095] [1251,938,1212] -4 hSpCas9 negative selection 6128067
56564203 56564226 X - 27260156 CAL120 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 0.056056419720634465 [718] [1060,1109,643] 0 hSpCas9 negative selection 6128068
56565489 56565512 X - 27260156 CADOES1 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.020684942531486117 [196] [231,198,161,148] 0 hSpCas9 negative selection 6185068
56564737 56564760 X + 27260156 CADOES1 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.32934074285140336 [222] [281,217,235,307] 5 hSpCas9 negative selection 6185069
56564457 56564480 X + 27260156 CADOES1 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.4328274238375044 [501] [607,614,590,709] 7 hSpCas9 negative selection 6185070
56564283 56564306 X - 27260156 CADOES1 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.12090675178702609 [333] [310,218,354,470] 2 hSpCas9 negative selection 6249317
56564657 56564680 X - 27260156 CADOES1 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.3441198621912436 [1095] [875,796,733,804] -5 hSpCas9 negative selection 6249318
56564203 56564226 X - 27260156 CADOES1 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.2336744282495044 [718] [626,533,586,524] -4 hSpCas9 negative selection 6249319
56565489 56565512 X - 27260156 EWS502 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.38213700912558 [196] [143,148,134,217] -6 hSpCas9 negative selection 6306319
56564737 56564760 X + 27260156 EWS502 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.3338465482102271 [222] [159,156,254,181] -5 hSpCas9 negative selection 6306320
56564457 56564480 X + 27260156 EWS502 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.41392804662970784 [501] [641,681,830,684] 7 hSpCas9 negative selection 6306321
56564283 56564306 X - 27260156 EWS502 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.14103500661949414 [333] [449,355,428,312] 2 hSpCas9 negative selection 6370568
56564657 56564680 X - 27260156 EWS502 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.22262638854577854 [1095] [949,1018,1053,954] -4 hSpCas9 negative selection 6370569
56564203 56564226 X - 27260156 EWS502 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.3213020350207288 [718] [675,405,581,783] -5 hSpCas9 negative selection 6370570
56565489 56565512 X - 27260156 EW8 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.31488597242553507 [196] [164,185,185,254] 6 hSpCas9 negative selection 6427570
56564737 56564760 X + 27260156 EW8 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.13112488548801515 [222] [203,141,199,244] 2 hSpCas9 negative selection 6427571
56564457 56564480 X + 27260156 EW8 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.21113941014975268 [501] [515,580,406,394] 4 hSpCas9 negative selection 6427572
56564283 56564306 X - 27260156 EW8 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.48797183412174344 [333] [468,306,384,364] 8 hSpCas9 negative selection 6491819
56564657 56564680 X - 27260156 EW8 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.3294495453254025 [1095] [681,756,478,942] -6 hSpCas9 negative selection 6491820
56564203 56564226 X - 27260156 EW8 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.06939987427114191 [718] [539,448,537,692] -1 hSpCas9 negative selection 6491821
56565489 56565512 X - 27260156 CORL105 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.11937694402880927 [196] [228,226,215,323] 2 hSpCas9 negative selection 6548821
56564737 56564760 X + 27260156 CORL105 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.4769949488500099 [222] [328,476,386,260] 8 hSpCas9 negative selection 6548822
56564457 56564480 X + 27260156 CORL105 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.37668665696352666 [501] [923,568,1012,594] 7 hSpCas9 negative selection 6548823
56564283 56564306 X - 27260156 CORL105 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.6083832013509968 [333] [534,493,511,828] 9 hSpCas9 negative selection 6613070
56564657 56564680 X - 27260156 CORL105 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.2394963935696287 [1095] [1132,1074,1162,989] -4 hSpCas9 negative selection 6613071
56564203 56564226 X - 27260156 CORL105 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.15865966128437164 [718] [722,539,890,885] -3 hSpCas9 negative selection 6613072
56565489 56565512 X - 27260156 HS294T viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.5081476034004452 [196] [109,124,99,94] 6 hSpCas9 negative selection 6670072
56564737 56564760 X + 27260156 HS294T viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.14301294462025416 [222] [96,40,82,92] -2 hSpCas9 negative selection 6670073
56564457 56564480 X + 27260156 HS294T viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.2975582880421649 [501] [184,167,179,465] 4 hSpCas9 negative selection 6670074
56564283 56564306 X - 27260156 HS294T viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.22336687528479343 [333] [78,85,199,265] 3 hSpCas9 negative selection 6734321
56564657 56564680 X - 27260156 HS294T viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.32787496820071527 [1095] [268,330,289,491] -4 hSpCas9 negative selection 6734322
56564203 56564226 X - 27260156 HS294T viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.42206602999502946 [718] [235,184,194,211] -5 hSpCas9 negative selection 6734323
56565489 56565512 X - 27260156 HCC44 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.10069285442637255 [196] [290,159,249,151] -2 hSpCas9 negative selection 6791323
56564737 56564760 X + 27260156 HCC44 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.18491602322969292 [222] [416,211,305,236] 3 hSpCas9 negative selection 6791324
56564457 56564480 X + 27260156 HCC44 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.09075682554733178 [501] [609,646,745,434] 1 hSpCas9 negative selection 6791325
56564283 56564306 X - 27260156 HCC44 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.6371049005545164 [333] [1004,538,432,392] 9 hSpCas9 negative selection 6855572
56564657 56564680 X - 27260156 HCC44 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.4146900256725389 [1095] [973,739,1207,870] -6 hSpCas9 negative selection 6855573
56564203 56564226 X - 27260156 HCC44 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.10868351580910007 [718] [1047,420,992,666] -2 hSpCas9 negative selection 6855574
56565489 56565512 X - 27260156 G402 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.2281642007069824 [196] [86,387,204,136] -3 hSpCas9 negative selection 6912574
56564737 56564760 X + 27260156 G402 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.3089897320818953 [222] [344,119,246,179] -4 hSpCas9 negative selection 6912575
56564457 56564480 X + 27260156 G402 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.4633939692142034 [501] [924,860,660,935] 6 hSpCas9 negative selection 6912576
56564283 56564306 X - 27260156 G402 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.8378530814033756 [333] [515,815,668,876] 9 hSpCas9 negative selection 6976823
56564657 56564680 X - 27260156 G402 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.08382140857724796 [1095] [1252,1824,1073,937] -1 hSpCas9 negative selection 6976824
56564203 56564226 X - 27260156 G402 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.34396228248586425 [718] [613,864,608,673] -4 hSpCas9 negative selection 6976825
56565489 56565512 X - 27260156 L33 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.16864307415026647 [196] [228,73,137,255] 4 hSpCas9 negative selection 7033825
56564737 56564760 X + 27260156 L33 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.11763771532792844 [222] [235,59,127,234] -3 hSpCas9 negative selection 7033826
56564457 56564480 X + 27260156 L33 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.5575725334181961 [501] [674,310,451,802] 9 hSpCas9 negative selection 7033827
56564283 56564306 X - 27260156 L33 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.33134254396197677 [333] [493,157,282,349] 7 hSpCas9 negative selection 7098074
56564657 56564680 X - 27260156 L33 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.40541497708171126 [1095] [777,382,506,791] -7 hSpCas9 negative selection 7098075
56564203 56564226 X - 27260156 L33 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.21316262092330118 [718] [586,207,516,565] -5 hSpCas9 negative selection 7098076
56565489 56565512 X - 27260156 K562 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.37361700096111805 [196] [138,325,238,201] 5 hSpCas9 negative selection 7155076
56564737 56564760 X + 27260156 K562 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.5047148473937002 [222] [68,88,242,146] -6 hSpCas9 negative selection 7155077
56564457 56564480 X + 27260156 K562 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.06589973364180382 [501] [691,524,325,354] 0 hSpCas9 negative selection 7155078
56564283 56564306 X - 27260156 K562 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.07778005248836062 [333] [305,307,405,237] 0 hSpCas9 negative selection 7219325
56564657 56564680 X - 27260156 K562 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.22264476444357817 [1095] [1018,926,715,703] -3 hSpCas9 negative selection 7219326
56564203 56564226 X - 27260156 K562 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.14771754293561046 [718] [381,543,641,700] -2 hSpCas9 negative selection 7219327
56565489 56565512 X - 27260156 HT29 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.3826853318512371 [196] [339,279,322,303] 7 hSpCas9 negative selection 7276327
56564737 56564760 X + 27260156 HT29 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.4082680192733048 [222] [290,239,441,437] 7 hSpCas9 negative selection 7276328
56564457 56564480 X + 27260156 HT29 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.2365809060873052 [501] [685,702,742,732] 4 hSpCas9 negative selection 7276329
56564283 56564306 X - 27260156 HT29 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.29154751998977113 [333] [550,412,617,409] 6 hSpCas9 negative selection 7340576
56564657 56564680 X - 27260156 HT29 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.34418075301583373 [1095] [1145,1346,1071,701] -6 hSpCas9 negative selection 7340577
56564203 56564226 X - 27260156 HT29 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.3274806516066369 [718] [906,815,625,484] -6 hSpCas9 negative selection 7340578
56565489 56565512 X - 27260156 MHHES1 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.39350396290288736 [196] [324,452,218,202] 7 hSpCas9 negative selection 7397578
56564737 56564760 X + 27260156 MHHES1 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.1822849952451222 [222] [226,356,210,122] -3 hSpCas9 negative selection 7397579
56564457 56564480 X + 27260156 MHHES1 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.6533695751547889 [501] [866,1190,744,784] 9 hSpCas9 negative selection 7397580
56564283 56564306 X - 27260156 MHHES1 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.47491091890440373 [333] [309,716,593,465] 8 hSpCas9 negative selection 7461827
56564657 56564680 X - 27260156 MHHES1 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 0.01152280979384357 [1095] [1030,1304,1135,1414] 0 hSpCas9 negative selection 7461828
56564203 56564226 X - 27260156 MHHES1 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.03881706093306192 [718] [957,1121,580,576] 0 hSpCas9 negative selection 7461829
56565489 56565512 X - 27260156 MEWO viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.44906071449371066 [196] [191,141,81] -7 hSpCas9 negative selection 7518829
56564737 56564760 X + 27260156 MEWO viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.13792071745976808 [222] [235,142,198] -3 hSpCas9 negative selection 7518830
56564457 56564480 X + 27260156 MEWO viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.35157525718537896 [501] [672,581,556] 7 hSpCas9 negative selection 7518831
56564283 56564306 X - 27260156 MEWO viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.5453212559506404 [333] [538,458,385] 9 hSpCas9 negative selection 7583078
56564657 56564680 X - 27260156 MEWO viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.12090715473129587 [1095] [876,911,1026] -3 hSpCas9 negative selection 7583079
56564203 56564226 X - 27260156 MEWO viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.1794243788478178 [718] [537,599,632] -4 hSpCas9 negative selection 7583080
56565489 56565512 X - 27260156 LNCAPCLONEFGC viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.1859333308522546 [196] [289,191,169,153] 3 hSpCas9 negative selection 7640080
56564737 56564760 X + 27260156 LNCAPCLONEFGC viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.10464874212795205 [222] [194,189,247,126] -2 hSpCas9 negative selection 7640081
56564457 56564480 X + 27260156 LNCAPCLONEFGC viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.31445396023341016 [501] [566,429,824,486] 5 hSpCas9 negative selection 7640082
56564283 56564306 X - 27260156 LNCAPCLONEFGC viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.2172612874745095 [333] [330,383,432,268] 3 hSpCas9 negative selection 7704329
56564657 56564680 X - 27260156 LNCAPCLONEFGC viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.3088712611659943 [1095] [868,672,871,808] -5 hSpCas9 negative selection 7704330
56564203 56564226 X - 27260156 LNCAPCLONEFGC viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.22979974404183523 [718] [531,434,651,624] -4 hSpCas9 negative selection 7704331
56565489 56565512 X - 27260156 PANC0327 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.14800301062732002 [196] [132,70,247,188] -2 hSpCas9 negative selection 7761331
56564737 56564760 X + 27260156 PANC0327 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.3033956265735357 [222] [208,221,370,175] 4 hSpCas9 negative selection 7761332
56564457 56564480 X + 27260156 PANC0327 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.38726194545905424 [501] [692,426,629,611] 6 hSpCas9 negative selection 7761333
56564283 56564306 X - 27260156 PANC0327 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.7041729967615906 [333] [541,621,305,449] 8 hSpCas9 negative selection 7825580
56564657 56564680 X - 27260156 PANC0327 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.06693108371164369 [1095] [978,736,797,1231] -1 hSpCas9 negative selection 7825581
56564203 56564226 X - 27260156 PANC0327 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.2981870013830662 [718] [576,450,471,590] -4 hSpCas9 negative selection 7825582
56565489 56565512 X - 27260156 NCIH2009 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.42186581358721886 [196] [464,400,257] 6 hSpCas9 negative selection 7882582
56564737 56564760 X + 27260156 NCIH2009 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.044012318537010486 [222] [281,252,367] 0 hSpCas9 negative selection 7882583
56564457 56564480 X + 27260156 NCIH2009 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.5596034963134721 [501] [1351,831,981] 7 hSpCas9 negative selection 7882584
56564283 56564306 X - 27260156 NCIH2009 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.5471484863693356 [333] [787,649,627] 7 hSpCas9 negative selection 7946831
56564657 56564680 X - 27260156 NCIH2009 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.3896378725779658 [1095] [1673,972,960] -5 hSpCas9 negative selection 7946832
56564203 56564226 X - 27260156 NCIH2009 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 0.10187152009770029 [718] [1368,958,963] 1 hSpCas9 negative selection 7946833
56565489 56565512 X - 27260156 NCIH1373 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.12311123807722169 [196] [493,128,175,55] 1 hSpCas9 negative selection 8003833
56564737 56564760 X + 27260156 NCIH1373 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.4720884907470584 [222] [199,371,207,156] 4 hSpCas9 negative selection 8003834
56564457 56564480 X + 27260156 NCIH1373 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.9408551358781214 [501] [1648,609,1005,314] 8 hSpCas9 negative selection 8003835
56564283 56564306 X - 27260156 NCIH1373 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.6662803018123319 [333] [985,404,465,157] 6 hSpCas9 negative selection 8068082
56564657 56564680 X - 27260156 NCIH1373 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 0.3291977427250543 [1095] [1226,1824,1530,393] 3 hSpCas9 negative selection 8068083
56564203 56564226 X - 27260156 NCIH1373 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 0.20421154093692084 [718] [786,930,1257,180] 2 hSpCas9 negative selection 8068084
56565489 56565512 X - 27260156 PATU8902 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 1.1594724008954806 [196] [815,585,261,905] 9 hSpCas9 negative selection 8125084
56564737 56564760 X + 27260156 PATU8902 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.5491713139329231 [222] [532,596,372,314] 6 hSpCas9 negative selection 8125085
56564457 56564480 X + 27260156 PATU8902 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.7367416839077849 [501] [1286,1227,1080,1062] 7 hSpCas9 negative selection 8125086
56564283 56564306 X - 27260156 PATU8902 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.9648815647804823 [333] [996,701,634,1420] 9 hSpCas9 negative selection 8189333
56564657 56564680 X - 27260156 PATU8902 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 0.2793232328982598 [1095] [1811,2596,772,2583] 3 hSpCas9 negative selection 8189334
56564203 56564226 X - 27260156 PATU8902 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 0.23822369253445042 [718] [1396,1162,590,1786] 2 hSpCas9 negative selection 8189335
56565489 56565512 X - 27260156 PANC1 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.09026186667895075 [196] [170,232,201,130] 1 hSpCas9 negative selection 8246335
56564737 56564760 X + 27260156 PANC1 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.3639104489930669 [222] [211,125,136,116] -5 hSpCas9 negative selection 8246336
56564457 56564480 X + 27260156 PANC1 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.6284148885058041 [501] [616,1097,478,565] 8 hSpCas9 negative selection 8246337
56564283 56564306 X - 27260156 PANC1 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.557280908822804 [333] [360,398,498,419] 8 hSpCas9 negative selection 8310584
56564657 56564680 X - 27260156 PANC1 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.1807933331950169 [1095] [727,958,1013,664] -3 hSpCas9 negative selection 8310585
56564203 56564226 X - 27260156 PANC1 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.1674571157281161 [718] [518,647,469,569] -3 hSpCas9 negative selection 8310586
56565489 56565512 X - 27260156 PANC0813 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.4193016030320925 [196] [494,197,281,280] 6 hSpCas9 negative selection 8367586
56564737 56564760 X + 27260156 PANC0813 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 -0.0636434108933932 [222] [257,186,184,365] -1 hSpCas9 negative selection 8367587
56564457 56564480 X + 27260156 PANC0813 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.7971420870683799 [501] [1090,690,1202,1113] 9 hSpCas9 negative selection 8367588
56564283 56564306 X - 27260156 PANC0813 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.3551493964004765 [333] [428,298,458,795] 6 hSpCas9 negative selection 8431835
56564657 56564680 X - 27260156 PANC0813 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.1658990225085113 [1095] [1013,1170,1287,1105] -3 hSpCas9 negative selection 8431836
56564203 56564226 X - 27260156 PANC0813 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.11985238688278987 [718] [673,986,754,686] -2 hSpCas9 negative selection 8431837
56565489 56565512 X - 27260156 RDES viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.03466673429399725 [196] [157,203,315,271] 0 hSpCas9 negative selection 8488837
56564737 56564760 X + 27260156 RDES viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.14656952699576997 [222] [205,293,186,482] 2 hSpCas9 negative selection 8488838
56564457 56564480 X + 27260156 RDES viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.07497829507192058 [501] [501,506,637,835] 1 hSpCas9 negative selection 8488839
56564283 56564306 X - 27260156 RDES viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.4727434353210509 [333] [437,512,475,740] 7 hSpCas9 negative selection 8553086
56564657 56564680 X - 27260156 RDES viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.06919788686218986 [1095] [1106,1150,1287,1256] -1 hSpCas9 negative selection 8553087
56564203 56564226 X - 27260156 RDES viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.07603395292995718 [718] [472,802,1016,918] -1 hSpCas9 negative selection 8553088
56565489 56565512 X - 27260156 PC3 viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 -0.3917902009170289 [196] [125,110,174,191] -7 hSpCas9 negative selection 8610088
56564737 56564760 X + 27260156 PC3 viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.19630688096730164 [222] [240,134,460,238] 4 hSpCas9 negative selection 8610089
56564457 56564480 X + 27260156 PC3 viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.3727786481990804 [501] [375,454,1378,743] 7 hSpCas9 negative selection 8610090
56564283 56564306 X - 27260156 PC3 viability CCCAAACGGGTTGCTATTTGTGG UBQLN2 ENSG00000188021 0.2891068268779514 [333] [304,440,620,335] 6 hSpCas9 negative selection 8674337
56564657 56564680 X - 27260156 PC3 viability CGTAAAGCATTATAGCCACCTGG UBQLN2 ENSG00000188021 -0.010871068208008206 [1095] [432,1116,2781,870] 0 hSpCas9 negative selection 8674338
56564203 56564226 X - 27260156 PC3 viability CATTGCTAGGCTGCGTGGACTGG UBQLN2 ENSG00000188021 -0.22393107220172231 [718] [290,559,1304,668] -5 hSpCas9 negative selection 8674339
56565489 56565512 X - 27260156 PATU8988T viability GGTTTCACTAGGTGCAGCGCTGG UBQLN2 ENSG00000188021 0.40619181572082563 [196] [263,144,314,275] 7 hSpCas9 negative selection 8731339
56564737 56564760 X + 27260156 PATU8988T viability GGGTAATCCATTTGCCTCCGTGG UBQLN2 ENSG00000188021 0.26036059628522523 [222] [288,213,316,202] 4 hSpCas9 negative selection 8731340
56564457 56564480 X + 27260156 PATU8988T viability TTTCGAATCCCGATCTGATGAGG UBQLN2 ENSG00000188021 0.42600975888853365 [501] [421,791,893,495] 7 hSpCas9 negative selection 8731341
56564283 56564306 X - 27260156 PATU8988T viability CCCAAACGGGTTGCTATTTGTGG UBQLN2