Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 2271
  • Symbol: fh
  • Description: fumarate hydratase
DataSource: http://genomecrispr.dkfz.de/#!/results/fh

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
241519601 241519624 1 + 26472758 Jiyoye viability GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -0.9316265319458852 [85] [33] -6 hSpCas9 negative selection 58066
241513602 241513625 1 - 26472758 Jiyoye viability AATAATGAAGGCAGCAGATGAGG FH ENSG00000091483 -0.6417342189750731 [179] [86] -4 hSpCas9 negative selection 58067
241519634 241519657 1 - 26472758 Jiyoye viability GCTTCGGCTCCCGGCTTGGGTGG FH ENSG00000091483 -0.7575693808307589 [277] [123] -5 hSpCas9 negative selection 58068
241504083 241504106 1 + 26472758 Jiyoye viability AATTCTCCCAGACCTGACCGAGG FH ENSG00000091483 -0.7422022425323532 [365] [164] -5 hSpCas9 negative selection 58069
241519649 241519672 1 + 26472758 Jiyoye viability GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -1.073951308230743 [66] [23] -6 hSpCas9 negative selection 58070
241512091 241512114 1 + 26472758 Jiyoye viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.8571652218285453 [441] [183] -6 hSpCas9 negative selection 58071
241502477 241502500 1 - 26472758 Jiyoye viability GTCACTGTCGGAGGCAGCAATGG FH ENSG00000091483 -1.9352168159412042 [354] [69] -8 hSpCas9 negative selection 58072
241511980 241512003 1 + 26472758 Jiyoye viability ACATGATCGTTGGGATGCACAGG FH ENSG00000091483 -2.2462668570980493 [150] [23] -8 hSpCas9 negative selection 58073
241517281 241517304 1 + 26472758 Jiyoye viability GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 -1.3090316524935355 [45] [13] -7 hSpCas9 negative selection 58074
241506068 241506091 1 - 26472758 Jiyoye viability GCAGCTGGAGGCACTGCTGTTGG FH ENSG00000091483 2.9921378822270293 [0] [5] 9 hSpCas9 negative selection 58075
241519601 241519624 1 + 26472758 KBM7 viability GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -0.07762295422458926 [509,483] [194,245] 0 hSpCas9 negative selection 249184
241513602 241513625 1 - 26472758 KBM7 viability AATAATGAAGGCAGCAGATGAGG FH ENSG00000091483 -0.8731762828856566 [767,742] [136,245] -6 hSpCas9 negative selection 249185
241519634 241519657 1 - 26472758 KBM7 viability GCTTCGGCTCCCGGCTTGGGTGG FH ENSG00000091483 -0.5636718243339691 [883,674] [400,106] -5 hSpCas9 negative selection 249186
241504083 241504106 1 + 26472758 KBM7 viability AATTCTCCCAGACCTGACCGAGG FH ENSG00000091483 -0.6182137172294587 [1220,881] [358,281] -5 hSpCas9 negative selection 249187
241519649 241519672 1 + 26472758 KBM7 viability GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 0.672794273471774 [133,55] [123,18] 7 hSpCas9 negative selection 249188
241512091 241512114 1 + 26472758 KBM7 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.6202894805682979 [1680,1422] [576,379] -5 hSpCas9 negative selection 249189
241502477 241502500 1 - 26472758 KBM7 viability GTCACTGTCGGAGGCAGCAATGG FH ENSG00000091483 -2.1282577140630203 [1674,1566] [238,116] -8 hSpCas9 negative selection 249190
241511980 241512003 1 + 26472758 KBM7 viability ACATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.3504824477218126 [475,451] [114,221] -3 hSpCas9 negative selection 249191
241517281 241517304 1 + 26472758 KBM7 viability GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 0.637501365420557 [89,67] [80,35] 7 hSpCas9 negative selection 249192
241506068 241506091 1 - 26472758 KBM7 viability GCAGCTGGAGGCACTGCTGTTGG FH ENSG00000091483 -3.98732160421337 [71,30] [1,0] -9 hSpCas9 negative selection 249193
241519601 241519624 1 + 26472758 Raji viability GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 0.08353679341923148 [121] [29] 0 hSpCas9 negative selection 440302
241513602 241513625 1 - 26472758 Raji viability AATAATGAAGGCAGCAGATGAGG FH ENSG00000091483 -1.1656349590328166 [492] [50] -7 hSpCas9 negative selection 440303
241519634 241519657 1 - 26472758 Raji viability GCTTCGGCTCCCGGCTTGGGTGG FH ENSG00000091483 0.22584236878195652 [408] [110] 2 hSpCas9 negative selection 440304
241504083 241504106 1 + 26472758 Raji viability AATTCTCCCAGACCTGACCGAGG FH ENSG00000091483 -0.09483100402521805 [496] [107] -1 hSpCas9 negative selection 440305
241519649 241519672 1 + 26472758 Raji viability GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -0.09425032579605097 [91] [19] -1 hSpCas9 negative selection 440306
241512091 241512114 1 + 26472758 Raji viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.6367775601968106 [669] [99] -5 hSpCas9 negative selection 440307
241502477 241502500 1 - 26472758 Raji viability GTCACTGTCGGAGGCAGCAATGG FH ENSG00000091483 -0.9071647731955557 [597] [73] -6 hSpCas9 negative selection 440308
241511980 241512003 1 + 26472758 Raji viability ACATGATCGTTGGGATGCACAGG FH ENSG00000091483 -1.6276825258771253 [252] [18] -8 hSpCas9 negative selection 440309
241517281 241517304 1 + 26472758 Raji viability GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.19517923464683196 [73] [14] -2 hSpCas9 negative selection 440310
241506068 241506091 1 - 26472758 Raji viability GCAGCTGGAGGCACTGCTGTTGG FH ENSG00000091483 -3.0625414660687134 [35] [0] -9 hSpCas9 negative selection 440311
241519601 241519624 1 + 26472758 K562 viability GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -0.6238370178723032 [501] [274] -4 hSpCas9 negative selection 631420
241513602 241513625 1 - 26472758 K562 viability AATAATGAAGGCAGCAGATGAGG FH ENSG00000091483 -0.6868217293578206 [716] [375] -4 hSpCas9 negative selection 631421
241519634 241519657 1 - 26472758 K562 viability GCTTCGGCTCCCGGCTTGGGTGG FH ENSG00000091483 0.20259855197181986 [874] [849] 1 hSpCas9 negative selection 631422
241504083 241504106 1 + 26472758 K562 viability AATTCTCCCAGACCTGACCGAGG FH ENSG00000091483 0.15549538436157362 [802] [754] 1 hSpCas9 negative selection 631423
241519649 241519672 1 + 26472758 K562 viability GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 4.066420425688452 [97] [1385] 9 hSpCas9 negative selection 631424
241512091 241512114 1 + 26472758 K562 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -2.1063162152812915 [1213] [237] -7 hSpCas9 negative selection 631425
241502477 241502500 1 - 26472758 K562 viability GTCACTGTCGGAGGCAGCAATGG FH ENSG00000091483 -2.7053243585624367 [1212] [156] -8 hSpCas9 negative selection 631426
241511980 241512003 1 + 26472758 K562 viability ACATGATCGTTGGGATGCACAGG FH ENSG00000091483 -1.5182525806922345 [301] [88] -6 hSpCas9 negative selection 631427
241517281 241517304 1 + 26472758 K562 viability GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 0.27416607106049895 [47] [48] 2 hSpCas9 negative selection 631428
241506068 241506091 1 - 26472758 K562 viability GCAGCTGGAGGCACTGCTGTTGG FH ENSG00000091483 -4.399437462108277 [24] [0] -9 hSpCas9 negative selection 631429
241506083 241506106 1 - 26627737 DLD1 viability AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -5.7486062237739795 [171] [0,0,0] -9 hSpCas9 negative selection 769960
241508602 241508625 1 - 26627737 DLD1 viability TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -4.383516355806524 [302] [11,0,0] -9 hSpCas9 negative selection 769961
241512091 241512114 1 + 26627737 DLD1 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -2.082808059887598 [1897] [81,189,148] -9 hSpCas9 negative selection 769962
241512091 241512114 1 - 26627737 DLD1 viability CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 1.279643313489312 [290] [257,188,214] 9 hSpCas9 negative selection 769963
241519590 241519613 1 - 26627737 DLD1 viability GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.1603737842903257 [190] [101,149,146] 9 hSpCas9 negative selection 769964
241519649 241519672 1 + 26627737 DLD1 viability GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 1.0773378010478165 [52] [0,61,41] 8 hSpCas9 negative selection 769965
241506083 241506106 1 - 26627737 GBM cells viability after 5 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -1.6783950532920353 [187] [21,40] -9 hSpCas9 negative selection 852275
241508602 241508625 1 - 26627737 GBM cells viability after 5 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.22183828457492472 [136] [43,81] -3 hSpCas9 negative selection 852276
241512091 241512114 1 + 26627737 GBM cells viability after 5 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.06039637637518269 [838] [420,441] -1 hSpCas9 negative selection 852277
241512091 241512114 1 - 26627737 GBM cells viability after 5 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.7591112350461626 [156] [130,153] 8 hSpCas9 negative selection 852278
241519590 241519613 1 - 26627737 GBM cells viability after 5 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.0132465503646806 [96] [119,89] 9 hSpCas9 negative selection 852279
241519649 241519672 1 + 26627737 GBM cells viability after 5 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 2.16194828071948 [9] [25,21] 9 hSpCas9 negative selection 852280
241506083 241506106 1 - 26627737 GBM cells viability after 13 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.995906352042942 [187] [70,34] -8 hSpCas9 negative selection 934590
241508602 241508625 1 - 26627737 GBM cells viability after 13 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.3882593516817685 [136] [58,54] -4 hSpCas9 negative selection 934591
241512091 241512114 1 + 26627737 GBM cells viability after 13 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.20404379429246045 [838] [419,374] -2 hSpCas9 negative selection 934592
241512091 241512114 1 - 26627737 GBM cells viability after 13 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 1.0853928995273345 [156] [177,182] 9 hSpCas9 negative selection 934593
241519590 241519613 1 - 26627737 GBM cells viability after 13 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.077083908795197 [96] [115,106] 9 hSpCas9 negative selection 934594
241519649 241519672 1 + 26627737 GBM cells viability after 13 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 1.9062976285912403 [9] [5,31] 9 hSpCas9 negative selection 934595
241506083 241506106 1 - 26627737 GBM cells viability after 21 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.9947190713259978 [187] [56,45] -7 hSpCas9 negative selection 1016905
241508602 241508625 1 - 26627737 GBM cells viability after 21 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.18511016463869367 [136] [77,53] -2 hSpCas9 negative selection 1016906
241512091 241512114 1 + 26627737 GBM cells viability after 21 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.3016922863073312 [838] [198,171] -8 hSpCas9 negative selection 1016907
241512091 241512114 1 - 26627737 GBM cells viability after 21 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 1.0522215454313 [156] [167,184] 9 hSpCas9 negative selection 1016908
241519590 241519613 1 - 26627737 GBM cells viability after 21 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.5131943626333011 [96] [81,68] 5 hSpCas9 negative selection 1016909
241519649 241519672 1 + 26627737 GBM cells viability after 21 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 2.5737512325213876 [9] [35,28] 9 hSpCas9 negative selection 1016910
241506083 241506106 1 - 26627737 RPE1 viability after 9 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 0.4565893257134328 [154] [80,47] 3 hSpCas9 negative selection 1099220
241508602 241508625 1 - 26627737 RPE1 viability after 9 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 0.7029152104100207 [158] [94,62] 4 hSpCas9 negative selection 1099221
241512091 241512114 1 + 26627737 RPE1 viability after 9 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.5476285146848727 [1770] [678,979] 4 hSpCas9 negative selection 1099222
241512091 241512114 1 - 26627737 RPE1 viability after 9 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.9407659589073717 [775] [478,449] 6 hSpCas9 negative selection 1099223
241519590 241519613 1 - 26627737 RPE1 viability after 9 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.7100270812652818 [334] [343,341] 8 hSpCas9 negative selection 1099224
241519649 241519672 1 + 26627737 RPE1 viability after 9 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 3.2531337002328002 [13] [60,16] 9 hSpCas9 negative selection 1099225
241506083 241506106 1 - 26627737 RPE1 viability after 12 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.7230263828975998 [154] [32,16] -5 hSpCas9 negative selection 1181535
241508602 241508625 1 - 26627737 RPE1 viability after 12 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 0.8387291895371687 [158] [38,115] 5 hSpCas9 negative selection 1181536
241512091 241512114 1 + 26627737 RPE1 viability after 12 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.09736574076404647 [1770] [509,507] 0 hSpCas9 negative selection 1181537
241512091 241512114 1 - 26627737 RPE1 viability after 12 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 1.0414166901444872 [775] [483,370] 6 hSpCas9 negative selection 1181538
241519590 241519613 1 - 26627737 RPE1 viability after 12 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.5076110002284202 [334] [252,258] 8 hSpCas9 negative selection 1181539
241519649 241519672 1 + 26627737 RPE1 viability after 12 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 2.377325987556465 [13] [3,35] 9 hSpCas9 negative selection 1181540
241506083 241506106 1 - 26627737 RPE1 viability after 15 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.501970276541456 [154] [4,55] -3 hSpCas9 negative selection 1263850
241508602 241508625 1 - 26627737 RPE1 viability after 15 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 0.6630196187985946 [158] [58,82] 4 hSpCas9 negative selection 1263851
241512091 241512114 1 + 26627737 RPE1 viability after 15 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.1953345949021843 [1770] [510,633] 1 hSpCas9 negative selection 1263852
241512091 241512114 1 - 26627737 RPE1 viability after 15 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.6561529178516333 [775] [546,151] 4 hSpCas9 negative selection 1263853
241519590 241519613 1 - 26627737 RPE1 viability after 15 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.2884730714182808 [334] [91,365] 7 hSpCas9 negative selection 1263854
241519649 241519672 1 + 26627737 RPE1 viability after 15 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 4.32645553724476 [13] [81,76] 9 hSpCas9 negative selection 1263855
241506083 241506106 1 - 26627737 RPE1 viability after 18 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 0.012682543461279394 [154] [47,35] 0 hSpCas9 negative selection 1346165
241508602 241508625 1 - 26627737 RPE1 viability after 18 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 0.9348375215310931 [158] [9,158] 5 hSpCas9 negative selection 1346166
241512091 241512114 1 + 26627737 RPE1 viability after 18 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.061461519772832096 [1770] [428,488] 0 hSpCas9 negative selection 1346167
241512091 241512114 1 - 26627737 RPE1 viability after 18 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.31844711052780106 [775] [206,318] 2 hSpCas9 negative selection 1346168
241519590 241519613 1 - 26627737 RPE1 viability after 18 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.5222294309942805 [334] [89,440] 7 hSpCas9 negative selection 1346169
241519649 241519672 1 + 26627737 RPE1 viability after 18 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 3.2409888266728792 [13] [12,59] 9 hSpCas9 negative selection 1346170
241506083 241506106 1 - 26627737 HeLa viability after 8 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.40019790915193476 [196] [58,90,44] -4 hSpCas9 negative selection 1428480
241508602 241508625 1 - 26627737 HeLa viability after 8 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.8719918403695807 [255] [79,33,71] -7 hSpCas9 negative selection 1428481
241512091 241512114 1 + 26627737 HeLa viability after 8 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.4775011278188641 [1864] [523,604,604] -5 hSpCas9 negative selection 1428482
241512091 241512114 1 - 26627737 HeLa viability after 8 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.8727079862132219 [643] [152,195,112] -7 hSpCas9 negative selection 1428483
241519590 241519613 1 - 26627737 HeLa viability after 8 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.6918753658588115 [192] [188,112,117] 6 hSpCas9 negative selection 1428484
241519649 241519672 1 + 26627737 HeLa viability after 8 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -1.9448744687896056 [148] [19,25,5] -9 hSpCas9 negative selection 1428485
241506083 241506106 1 - 26627737 HeLa viability after 12 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.27475107887869177 [196] [65,46,90] -2 hSpCas9 negative selection 1510795
241508602 241508625 1 - 26627737 HeLa viability after 12 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.9771615642386285 [255] [50,73,33] -7 hSpCas9 negative selection 1510796
241512091 241512114 1 + 26627737 HeLa viability after 12 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.0624569300079345 [1864] [363,349,394] -7 hSpCas9 negative selection 1510797
241512091 241512114 1 - 26627737 HeLa viability after 12 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.5122706802333357 [643] [160,271,116] -4 hSpCas9 negative selection 1510798
241519590 241519613 1 - 26627737 HeLa viability after 12 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.6853492294436159 [192] [151,94,141] 5 hSpCas9 negative selection 1510799
241519649 241519672 1 + 26627737 HeLa viability after 12 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -2.074261255553594 [148] [3,0,39] -9 hSpCas9 negative selection 1510800
241506083 241506106 1 - 26627737 HeLa viability after 15 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.6162868743509666 [196] [70,41,42] -5 hSpCas9 negative selection 1593110
241508602 241508625 1 - 26627737 HeLa viability after 15 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.4674528503979981 [255] [44,51,133] -4 hSpCas9 negative selection 1593111
241512091 241512114 1 + 26627737 HeLa viability after 15 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.282131729234877 [1864] [401,177,358] -8 hSpCas9 negative selection 1593112
241512091 241512114 1 - 26627737 HeLa viability after 15 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.8329627221581916 [643] [53,177,215] -6 hSpCas9 negative selection 1593113
241519590 241519613 1 - 26627737 HeLa viability after 15 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.9983250537805372 [192] [62,216,194] 7 hSpCas9 negative selection 1593114
241519649 241519672 1 + 26627737 HeLa viability after 15 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -0.4944315250814042 [148] [31,45,51] -4 hSpCas9 negative selection 1593115
241506083 241506106 1 - 26627737 HeLa viability after 18 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.569702615696694 [196] [49,35,42] -5 hSpCas9 negative selection 1675425
241508602 241508625 1 - 26627737 HeLa viability after 18 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.4560776320821155 [255] [28,45,133] -4 hSpCas9 negative selection 1675426
241512091 241512114 1 + 26627737 HeLa viability after 18 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.273226188081519 [1864] [272,147,358] -8 hSpCas9 negative selection 1675427
241512091 241512114 1 - 26627737 HeLa viability after 18 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.8346926999822469 [643] [36,145,215] -6 hSpCas9 negative selection 1675428
241519590 241519613 1 - 26627737 HeLa viability after 18 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 1.002024073290863 [192] [37,185,194] 7 hSpCas9 negative selection 1675429
241519649 241519672 1 + 26627737 HeLa viability after 18 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -0.5748761065148447 [148] [16,37,51] -5 hSpCas9 negative selection 1675430
241506083 241506106 1 - 26627737 HCT116 viability after 6 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -1.9334695747263986 [344] [19,10] -8 hSpCas9 negative selection 1757740
241508602 241508625 1 - 26627737 HCT116 viability after 6 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 0.46815184297886425 [509] [117,106] 2 hSpCas9 negative selection 1757741
241512091 241512114 1 + 26627737 HCT116 viability after 6 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.23533056450954115 [2321] [430,428] 1 hSpCas9 negative selection 1757742
241512091 241512114 1 - 26627737 HCT116 viability after 6 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -1.064208632334926 [387] [72,4] -6 hSpCas9 negative selection 1757743
241519590 241519613 1 - 26627737 HCT116 viability after 6 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 2.2517342794290625 [219] [136,179] 9 hSpCas9 negative selection 1757744
241519649 241519672 1 + 26627737 HCT116 viability after 6 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 0.6022195800714152 [30] [18,0] 3 hSpCas9 negative selection 1757745
241506083 241506106 1 - 26627737 HCT116 viability after 8 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.361594184294167 [149] [52,92,46] -4 hSpCas9 negative selection 1840055
241508602 241508625 1 - 26627737 HCT116 viability after 8 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -0.5645197278736127 [245] [125,91,57] -6 hSpCas9 negative selection 1840056
241512091 241512114 1 + 26627737 HCT116 viability after 8 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.0780555514954926 [1450] [355,339,438] -8 hSpCas9 negative selection 1840057
241512091 241512114 1 - 26627737 HCT116 viability after 8 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.7531786107268088 [207] [242,190,146] 7 hSpCas9 negative selection 1840058
241519590 241519613 1 - 26627737 HCT116 viability after 8 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.16299676801284224 [144] [103,105,58] 2 hSpCas9 negative selection 1840059
241519649 241519672 1 + 26627737 HCT116 viability after 8 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -2.1617208923511906 [48] [2,4,9] -9 hSpCas9 negative selection 1840060
241506083 241506106 1 - 26627737 HCT116 viability after 9 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.8096089357639913 [344] [51,52] -5 hSpCas9 negative selection 1922370
241508602 241508625 1 - 26627737 HCT116 viability after 9 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -2.6761550236287377 [509] [46,0] -9 hSpCas9 negative selection 1922371
241512091 241512114 1 + 26627737 HCT116 viability after 9 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.5470776128393968 [2321] [711,196] -4 hSpCas9 negative selection 1922372
241512091 241512114 1 - 26627737 HCT116 viability after 9 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.5259890333066499 [387] [218,93] 4 hSpCas9 negative selection 1922373
241519590 241519613 1 - 26627737 HCT116 viability after 9 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.9265684844503129 [219] [133,93] 6 hSpCas9 negative selection 1922374
241519649 241519672 1 + 26627737 HCT116 viability after 9 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 2.9803418931032257 [30] [4,112] 9 hSpCas9 negative selection 1922375
241506083 241506106 1 - 26627737 HCT116 viability after 12 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -1.2434644625056541 [149] [17,23,58] -8 hSpCas9 negative selection 2004685
241508602 241508625 1 - 26627737 HCT116 viability after 12 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -3.883805769284628 [245] [9,1,13] -9 hSpCas9 negative selection 2004686
241512091 241512114 1 + 26627737 HCT116 viability after 12 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.6076681963921466 [1450] [189,335,231] -9 hSpCas9 negative selection 2004687
241512091 241512114 1 - 26627737 HCT116 viability after 12 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.5972986001275655 [207] [140,195,161] 5 hSpCas9 negative selection 2004688
241519590 241519613 1 - 26627737 HCT116 viability after 12 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 -0.19112946251611618 [144] [33,61,106] -2 hSpCas9 negative selection 2004689
241519649 241519672 1 + 26627737 HCT116 viability after 12 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 -1.3218897532095686 [48] [17,0,10] -8 hSpCas9 negative selection 2004690
241506083 241506106 1 - 26627737 HCT116 viability after 15 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -0.5686567314486768 [149] [33,52,83] -5 hSpCas9 negative selection 2087000
241508602 241508625 1 - 26627737 HCT116 viability after 15 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -5.3638002428255085 [245] [8,0,0] -9 hSpCas9 negative selection 2087001
241512091 241512114 1 + 26627737 HCT116 viability after 15 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -2.382353454219868 [1450] [174,202,103] -9 hSpCas9 negative selection 2087002
241512091 241512114 1 - 26627737 HCT116 viability after 15 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 1.0994992117504965 [207] [287,244,238] 8 hSpCas9 negative selection 2087003
241519590 241519613 1 - 26627737 HCT116 viability after 15 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.6571857790368254 [144] [91,67,227] 6 hSpCas9 negative selection 2087004
241519649 241519672 1 + 26627737 HCT116 viability after 15 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 0.40885132796922186 [48] [52,24,35] 4 hSpCas9 negative selection 2087005
241506083 241506106 1 - 26627737 HCT116 viability after 18 days AGAATCTATGAGCTCGCAGCTGG FH ENSG00000091483 -1.8547837827103897 [149] [32,15,10] -9 hSpCas9 negative selection 2169315
241508602 241508625 1 - 26627737 HCT116 viability after 18 days TGTTCCACTTACTCTTGGGCAGG FH ENSG00000091483 -2.7772604141561694 [245] [0,32,16] -9 hSpCas9 negative selection 2169316
241512091 241512114 1 + 26627737 HCT116 viability after 18 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -3.116953276520058 [1450] [16,111,112] -9 hSpCas9 negative selection 2169317
241512091 241512114 1 - 26627737 HCT116 viability after 18 days CCTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.2702758754558459 [207] [122,101,140] 2 hSpCas9 negative selection 2169318
241519590 241519613 1 - 26627737 HCT116 viability after 18 days GCCTCCGAACGCGGCTCGAATGG FH ENSG00000091483 0.7014019455165428 [144] [40,117,185] 6 hSpCas9 negative selection 2169319
241519649 241519672 1 + 26627737 HCT116 viability after 18 days GCCGAAGCTAAGGCTGCGGCTGG FH ENSG00000091483 0.009528762581070715 [48] [64,2,3] 0 hSpCas9 negative selection 2169320
241513652 241513675 1 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity ATAATCCTGGTTTACTTCAGCGG FH ENSG00000091483 -1.2570022597066577 [2,2] [0,0] -9 hSpCas9 positive selection 2988660
241519705 241519728 1 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 -0.32597605495596504 [3,2] [3,0] -4 hSpCas9 positive selection 2988661
241519602 241519625 1 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -0.9654813927589663 [2,2] [0,0] -9 hSpCas9 positive selection 2988662
241517282 241517305 1 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.19920665098002338 [4,4] [4,2] -3 hSpCas9 positive selection 2988663
241513652 241513675 1 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity ATAATCCTGGTTTACTTCAGCGG FH ENSG00000091483 -0.887370933247059 [2,2] [0,0] -9 hSpCas9 positive selection 3056518
241519705 241519728 1 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 -0.5339560920877291 [3,3] [2,0] -7 hSpCas9 positive selection 3056519
241519602 241519625 1 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -0.018693692779599036 [2,2] [2,0] 0 hSpCas9 positive selection 3056520
241517282 241517305 1 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.1325850917243578 [4,4] [4,1] -2 hSpCas9 positive selection 3056521
241513691 241513714 - 24336571 A375 resistance to PLX after 7 days ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.09322427145866824 [8,9] [8,7] -3 hSpCas9 positive selection 3114766
241513656 241513679 - 24336571 A375 resistance to PLX after 7 days AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.002020953232466649 [2,2] [2,1] 0 hSpCas9 positive selection 3114767
241512091 241512114 + 24336571 A375 resistance to PLX after 7 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.8921362030535476 [5,6] [10,14] 9 hSpCas9 positive selection 3114768
241511966 241511989 - 24336571 A375 resistance to PLX after 7 days CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.03946675711667624 [5,5] [6,4] 1 hSpCas9 positive selection 3114769
241513614 241513637 - 24336571 A375 resistance to PLX after 7 days GATTGCTAATGCAATAATGAAGG FH ENSG00000091483 0.4005069889145154 [4,2] [4,5] 8 hSpCas9 positive selection 3114770
241511970 241511993 + 24336571 A375 resistance to PLX after 7 days GCTTTTATTAACATGATCGTTGG FH ENSG00000091483 -0.3882303793555966 [11,13] [8,10] -9 hSpCas9 positive selection 3114771
241513691 241513714 - 24336571 A375 resistance to PLX after 14 days ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.2707519408392268 [8,7] [2,2] -3 hSpCas9 positive selection 3172559
241513656 241513679 - 24336571 A375 resistance to PLX after 14 days AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.7809849381229936 [1,1] [1,1] 6 hSpCas9 positive selection 3172560
241512091 241512114 + 24336571 A375 resistance to PLX after 14 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 2.3476052194049326 [3,1] [6,7] 9 hSpCas9 positive selection 3172561
241511966 241511989 - 24336571 A375 resistance to PLX after 14 days CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.6331908859491441 [4,3] [2,2] 5 hSpCas9 positive selection 3172562
241513614 241513637 - 24336571 A375 resistance to PLX after 14 days GATTGCTAATGCAATAATGAAGG FH ENSG00000091483 2.16632963728114 [1,1] [4,3] 9 hSpCas9 positive selection 3172563
241511970 241511993 + 24336571 A375 resistance to PLX after 14 days GCTTTTATTAACATGATCGTTGG FH ENSG00000091483 -0.04863858626795109 [11,9] [3,4] 0 hSpCas9 positive selection 3172564
241513691 241513714 - 24336571 A375 viability after 7 days ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.01278838631756446 [9] [8,9] 0 hSpCas9 negative selection 3230352
241513656 241513679 - 24336571 A375 viability after 7 days AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.4051664640481607 [3] [2,2] -5 hSpCas9 negative selection 3230353
241512091 241512114 + 24336571 A375 viability after 7 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.549307436728723 [10] [5,6] -7 hSpCas9 negative selection 3230354
241511966 241511989 - 24336571 A375 viability after 7 days CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.9788899317768174 [2] [5,5] 9 hSpCas9 negative selection 3230355
241513614 241513637 - 24336571 A375 viability after 7 days GATTGCTAATGCAATAATGAAGG FH ENSG00000091483 -0.44777382693738654 [5] [4,2] -6 hSpCas9 negative selection 3230356
241511970 241511993 + 24336571 A375 viability after 7 days GCTTTTATTAACATGATCGTTGG FH ENSG00000091483 2.1472467403276987 [2] [11,13] 9 hSpCas9 negative selection 3230357
241513691 241513714 - 24336571 A375 viability after 14 days ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.15030531209441622 [9] [8,7] -2 hSpCas9 negative selection 3288145
241513656 241513679 - 24336571 A375 viability after 14 days AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.7347092604191046 [3] [1,1] -7 hSpCas9 negative selection 3288146
241512091 241512114 + 24336571 A375 viability after 14 days CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.6454968392736018 [10] [3,1] -9 hSpCas9 negative selection 3288147
241511966 241511989 - 24336571 A375 viability after 14 days CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.6290741937197757 [2] [4,3] 7 hSpCas9 negative selection 3288148
241513614 241513637 - 24336571 A375 viability after 14 days GATTGCTAATGCAATAATGAAGG FH ENSG00000091483 -1.308097299676533 [5] [1,1] -9 hSpCas9 negative selection 3288149
241511970 241511993 + 24336571 A375 viability after 14 days GCTTTTATTAACATGATCGTTGG FH ENSG00000091483 1.9141104622119005 [2] [11,9] 9 hSpCas9 negative selection 3288150
241512091 241512114 1 + 27383988 293T resistance to West Nile virus (flavivirus) CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.29500384058313767 [218,155] [0,0] -2 hSpCas9 positive selection 3350073
241513656 241513679 1 - 27383988 293T resistance to West Nile virus (flavivirus) AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 1.2033914594063921 [56,75] [0,0] 5 hSpCas9 positive selection 3350074
241517212 241517235 1 + 27383988 293T resistance to West Nile virus (flavivirus) AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 0.5700934911157001 [110,94] [0,0] 3 hSpCas9 positive selection 3350075
241517240 241517263 1 + 27383988 293T resistance to West Nile virus (flavivirus) GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.7760967900916153 [261,261] [0,0] -5 hSpCas9 positive selection 3369289
241511966 241511989 1 - 27383988 293T resistance to West Nile virus (flavivirus) CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.5708256842626168 [102,102] [0,0] 3 hSpCas9 positive selection 3369290
241513691 241513714 1 - 27383988 293T resistance to West Nile virus (flavivirus) ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.06750165256581787 [145,145] [0,0] 0 hSpCas9 positive selection 3369291
241513651 241513674 1 + 26780180 HT29 viability (Avana library 4 designs) ATAATCCTGGTTTACTTCAGCGG FH ENSG00000091483 2.78816208384194 [] [] 8 hSpCas9 negative selection 3425570
241519705 241519728 1 - 26780180 HT29 viability (Avana library 4 designs) GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 2.74745795715576 [] [] 8 hSpCas9 negative selection 3425571
241519601 241519624 1 + 26780180 HT29 viability (Avana library 4 designs) GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 1.7093389138892 [] [] 6 hSpCas9 negative selection 3425572
241517281 241517304 1 + 26780180 HT29 viability (Avana library 4 designs) GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 2.41976015063216 [] [] 8 hSpCas9 negative selection 3425573
241519601 241519624 1 + 26780180 A375 viability (Avana lentiCRISPRv2) GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -2.56516389541877 [] [] -3 hSpCas9 negative selection 3507762
241517281 241517304 1 + 26780180 A375 viability (Avana lentiCRISPRv2) GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 -2.46919740620074 [] [] -3 hSpCas9 negative selection 3507763
241519705 241519728 1 - 26780180 A375 viability (Avana lentiCRISPRv2) GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 -2.16959061151094 [] [] -3 hSpCas9 negative selection 3507764
241513651 241513674 1 + 26780180 A375 viability (Avana lentiCRISPRv2) ATAATCCTGGTTTACTTCAGCGG FH ENSG00000091483 -15.3272391102832 [] [] -9 hSpCas9 negative selection 3507765
241512022 241512045 1 - 26780180 A375 viability (Avana lentiCRISPRv2) AGAGCAATTGAAATGTTAGGAGG FH ENSG00000091483 -3.18657507591237 [] [] -4 hSpCas9 negative selection 3507766
241519645 241519668 1 + 26780180 A375 viability (Avana lentiCRISPRv2) GGGAGCCGAAGCTAAGGCTGCGG FH ENSG00000091483 2.3714062195077 [] [] 3 hSpCas9 negative selection 3507767
241519601 241519624 1 + 26780180 A375 viability (Avana lentiGuide) GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 19.7811855185065 [] [] 8 hSpCas9 negative selection 3616421
241517281 241517304 1 + 26780180 A375 viability (Avana lentiGuide) GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 10.9605316749647 [] [] 7 hSpCas9 negative selection 3616422
241519705 241519728 1 - 26780180 A375 viability (Avana lentiGuide) GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 2.51038798498218 [] [] 2 hSpCas9 negative selection 3616423
241513651 241513674 1 + 26780180 A375 viability (Avana lentiGuide) ATAATCCTGGTTTACTTCAGCGG FH ENSG00000091483 11.8284507366929 [] [] 7 hSpCas9 negative selection 3616424
241512022 241512045 1 - 26780180 A375 viability (Avana lentiGuide) AGAGCAATTGAAATGTTAGGAGG FH ENSG00000091483 10.2028756974033 [] [] 7 hSpCas9 negative selection 3616425
241519645 241519668 1 + 26780180 A375 viability (Avana lentiGuide) GGGAGCCGAAGCTAAGGCTGCGG FH ENSG00000091483 4.86790426882548 [] [] 4 hSpCas9 negative selection 3616426
241519601 241519624 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -0.12304982715407908 [4] [4,2] -2 hSpCas9 positive selection 3725080
241517281 241517304 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.14938995638005476 [7] [6,5] -2 hSpCas9 positive selection 3725081
241519705 241519728 1 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 -0.12880721055962874 [3] [3,2] -2 hSpCas9 positive selection 3725082
241513651 241513674 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ATAATCCTGGTTTACTTCAGCGG FH ENSG00000091483 -0.08800650788917408 [5] [4,5] -1 hSpCas9 positive selection 3725083
241512022 241512045 1 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) AGAGCAATTGAAATGTTAGGAGG FH ENSG00000091483 0.008226192473613891 [7] [7,6] 0 hSpCas9 positive selection 3725084
241519645 241519668 1 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GGGAGCCGAAGCTAAGGCTGCGG FH ENSG00000091483 0.21315440186864218 [4] [4,5] 6 hSpCas9 positive selection 3725085
241519601 241519624 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCGTTCGGAGGCCAAAACGAGGG FH ENSG00000091483 -0.5073973983018963 [4] [2,2] -6 hSpCas9 positive selection 3833687
241517281 241517304 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GGTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.24766394260408736 [6] [4,4] -3 hSpCas9 positive selection 3833688
241519705 241519728 1 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 -1.146064919644326 [4] [0,1] -8 hSpCas9 positive selection 3833689
241513651 241513674 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ATAATCCTGGTTTACTTCAGCGG FH ENSG00000091483 -0.9728813824263689 [4] [1,0] -8 hSpCas9 positive selection 3833690
241512022 241512045 1 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) AGAGCAATTGAAATGTTAGGAGG FH ENSG00000091483 -0.008576337904167564 [6] [6,4] 0 hSpCas9 positive selection 3833691
241519645 241519668 1 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GGGAGCCGAAGCTAAGGCTGCGG FH ENSG00000091483 -0.43976061062237193 [5] [1,3] -5 hSpCas9 positive selection 3833692
241517212 241517235 1 + 26780180 A375 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 1.71232323172024 [] [] 9 hSpCas9 negative selection 3940973
241513691 241513714 1 - 26780180 A375 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 1.65782465793006 [] [] 8 hSpCas9 negative selection 3940974
241513656 241513679 1 - 26780180 A375 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 1.86319761278161 [] [] 9 hSpCas9 negative selection 3940975
241512091 241512114 1 + 26780180 A375 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 1.63450026908834 [] [] 8 hSpCas9 negative selection 3940976
241511966 241511989 1 - 26780180 A375 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 1.45432414469871 [] [] 8 hSpCas9 negative selection 3940977
241517240 241517263 1 + 26780180 A375 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.771497423887223 [] [] 3 hSpCas9 negative selection 3940978
241517212 241517235 1 + 26780180 HT29 viability (GeCKOv2 library) AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 1.97541814041054 [] [] 9 hSpCas9 negative selection 4048939
241513691 241513714 1 - 26780180 HT29 viability (GeCKOv2 library) ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 1.00016926662701 [] [] 4 hSpCas9 negative selection 4048940
241513656 241513679 1 - 26780180 HT29 viability (GeCKOv2 library) AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 1.88023522034193 [] [] 8 hSpCas9 negative selection 4048941
241512091 241512114 1 + 26780180 HT29 viability (GeCKOv2 library) CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 2.75618039133657 [] [] 9 hSpCas9 negative selection 4048942
241511966 241511989 1 - 26780180 HT29 viability (GeCKOv2 library) CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 1.94847603165838 [] [] 9 hSpCas9 negative selection 4048943
241517240 241517263 1 + 26780180 HT29 viability (GeCKOv2 library) GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.581603640866527 [] [] 2 hSpCas9 negative selection 4048944
241513691 241513714 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.4311501287142929 [4] [2,1] -8 hSpCas9 positive selection 4137805
241513656 241513679 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.8318559627898685 [2] [0,0] -9 hSpCas9 positive selection 4137806
241512091 241512114 1 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.16311683683267364 [3] [2,2] 4 hSpCas9 positive selection 4137807
241511966 241511989 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.06833604276674998 [1] [0,1] -2 hSpCas9 positive selection 4137808
241513614 241513637 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) GATTGCTAATGCAATAATGAAGG FH ENSG00000091483 0.6558281148759684 [1] [1,1] 9 hSpCas9 positive selection 4137809
241511970 241511993 1 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) GCTTTTATTAACATGATCGTTGG FH ENSG00000091483 -0.20015219539091375 [3] [1,2] -5 hSpCas9 positive selection 4137810
241513691 241513714 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 2.1661237699956617 [1] [0,4,4,4] 9 hSpCas9 positive selection 4201827
241513656 241513679 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.7689209622167663 [1] [3,0,0,0] 5 hSpCas9 positive selection 4201828
241512091 241512114 1 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 1.4986598272932912 [2] [4,3,0,3] 9 hSpCas9 positive selection 4201829
241511966 241511989 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.0021979230697740104 [3] [0,0,4,0] 0 hSpCas9 positive selection 4201830
241513614 241513637 1 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) GATTGCTAATGCAATAATGAAGG FH ENSG00000091483 0.46464541180237484 [0] [0,0,0,0] 3 hSpCas9 positive selection 4201831
241511970 241511993 1 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) GCTTTTATTAACATGATCGTTGG FH ENSG00000091483 0.8888789513581453 [3] [0,0,2,4] 6 hSpCas9 positive selection 4201832
241512091 241512114 1 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.15072524940864937 [3] [3,2] 3 hSpCas9 positive selection 4271159
241513656 241513679 1 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.20874384576341964 [2] [2,0] -4 hSpCas9 positive selection 4271160
241517212 241517235 1 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.3507557807298963 [2] [2,0] -6 hSpCas9 positive selection 4271161
241517240 241517263 1 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.2772454758989627 [2] [2,2] 5 hSpCas9 positive selection 4335424
241511966 241511989 1 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.6505709010464504 [2] [1,0] -9 hSpCas9 positive selection 4335425
241513691 241513714 1 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.23979687308971667 [3] [3,1] 5 hSpCas9 positive selection 4335426
241511981 241512003 1 + 27760321 OCIAML3 viability CATGATCGTTGGGATGCACAGG FH ENSG00000091483 0.349869932207314 [0,0] [0,0] 4 hSpCas9 negative selection 4401263
241512091 241512113 1 - 27760321 OCIAML3 viability CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.7610385920645293 [607,538] [268,257] -6 hSpCas9 negative selection 4401264
241517218 241517240 1 + 27760321 OCIAML3 viability CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -1.972293000682134 [908,724] [160,162] -9 hSpCas9 negative selection 4401265
241517282 241517304 1 + 27760321 OCIAML3 viability GTATCATATTCTATCCGGAAGG FH ENSG00000091483 0.4734614981332739 [102,79] [102,92] 5 hSpCas9 negative selection 4401266
241519599 241519621 1 - 27760321 OCIAML3 viability TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.15056503732386972 [731,698] [450,574] -2 hSpCas9 negative selection 4401267
241511981 241512003 1 + 27760321 OCIAML2 viability CATGATCGTTGGGATGCACAGG FH ENSG00000091483 0.3011245669422653 [0,0] [0,0] 4 hSpCas9 negative selection 4484726
241512091 241512113 1 - 27760321 OCIAML2 viability CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.1549670133925172 [607,538] [415,415] -2 hSpCas9 negative selection 4484727
241517218 241517240 1 + 27760321 OCIAML2 viability CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -1.0745997090302073 [908,724] [320,299] -7 hSpCas9 negative selection 4484728
241517282 241517304 1 + 27760321 OCIAML2 viability GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.5924247893838581 [102,79] [43,54] -6 hSpCas9 negative selection 4484729
241519599 241519621 1 - 27760321 OCIAML2 viability TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 0.04985993804801414 [731,698] [495,736] 0 hSpCas9 negative selection 4484730
241511981 241512003 1 + 27760321 MV411 viability CATGATCGTTGGGATGCACAGG FH ENSG00000091483 0.5949485011219959 [0,0] [0,0] 4 hSpCas9 negative selection 4568189
241512091 241512113 1 - 27760321 MV411 viability CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.12108202297887227 [607,538] [119,688] -1 hSpCas9 negative selection 4568190
241517218 241517240 1 + 27760321 MV411 viability CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -1.9374960732879665 [908,724] [35,295] -8 hSpCas9 negative selection 4568191
241517282 241517304 1 + 27760321 MV411 viability GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -5.905839069299017 [102,79] [0,0] -9 hSpCas9 negative selection 4568192
241519599 241519621 1 - 27760321 MV411 viability TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.7375459582673645 [731,698] [253,327] -5 hSpCas9 negative selection 4568193
241511981 241512003 1 + 27760321 HL60 viability CATGATCGTTGGGATGCACAGG FH ENSG00000091483 0.2870783393278593 [0,0] [0,0] 3 hSpCas9 negative selection 4651652
241512091 241512113 1 - 27760321 HL60 viability CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.7265234790818831 [607,538] [287,276] -6 hSpCas9 negative selection 4651653
241517218 241517240 1 + 27760321 HL60 viability CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -1.6065731778730084 [908,724] [245,187] -8 hSpCas9 negative selection 4651654
241517282 241517304 1 + 27760321 HL60 viability GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.5280880564479111 [102,79] [66,34] -5 hSpCas9 negative selection 4651655
241519599 241519621 1 - 27760321 HL60 viability TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.027288522136238336 [731,698] [468,685] 0 hSpCas9 negative selection 4651656
241511981 241512003 1 + 27760321 HT1080 viability CATGATCGTTGGGATGCACAGG FH ENSG00000091483 1.3056276939190559 [0,0] [0,0] 7 hSpCas9 negative selection 4735115
241512091 241512113 1 - 27760321 HT1080 viability CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -2.477263983396732 [538,420] [30,37] -7 hSpCas9 negative selection 4735116
241517218 241517240 1 + 27760321 HT1080 viability CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -2.2336474051024577 [724,565] [89,15] -6 hSpCas9 negative selection 4735117
241517282 241517304 1 + 27760321 HT1080 viability GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -2.882719236834469 [79,62] [0,6] -7 hSpCas9 negative selection 4735118
241519599 241519621 1 - 27760321 HT1080 viability TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.5059669284053567 [698,545] [166,182] -2 hSpCas9 negative selection 4735119
241511981 241512003 1 + 27760321 HT29 viability after 7 days CATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.3840325596302083 [0,0] [0,0,0] -5 hSpCas9 negative selection 4818578
241512091 241512113 1 - 27760321 HT29 viability after 7 days CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.0021579794367786453 [538,420] [725,695,446] 0 hSpCas9 negative selection 4818579
241517218 241517240 1 + 27760321 HT29 viability after 7 days CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -0.33733449981234054 [724,565] [667,762,543] -5 hSpCas9 negative selection 4818580
241517282 241517304 1 + 27760321 HT29 viability after 7 days GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.6958127604862474 [79,62] [18,60,83] -7 hSpCas9 negative selection 4818581
241519599 241519621 1 - 27760321 HT29 viability after 7 days TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.20158883880199419 [698,545] [574,709,781] -3 hSpCas9 negative selection 4818582
241511981 241512003 1 + 27760321 HT29 viability after 25 days CATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.21405457092746794 [0,0] [0,0,0] -2 hSpCas9 negative selection 4902041
241512091 241512113 1 - 27760321 HT29 viability after 25 days CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.9135079044316179 [538,420] [329,273,263] -6 hSpCas9 negative selection 4902042
241517218 241517240 1 + 27760321 HT29 viability after 25 days CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -1.7373364261223945 [724,565] [287,194,170] -7 hSpCas9 negative selection 4902043
241517282 241517304 1 + 27760321 HT29 viability after 25 days GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -1.7453947366495468 [79,62] [11,27,34] -7 hSpCas9 negative selection 4902044
241519599 241519621 1 - 27760321 HT29 viability after 25 days TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.29582673565137224 [698,545] [495,615,636] -3 hSpCas9 negative selection 4902045
241511981 241512003 1 + 27760321 HT29 viability after 22 days CATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.23137320278672746 [0,0] [0,0,0] -2 hSpCas9 negative selection 4985504
241512091 241512113 1 - 27760321 HT29 viability after 22 days CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.574640381190981 [538,420] [353,424,338] -5 hSpCas9 negative selection 4985505
241517218 241517240 1 + 27760321 HT29 viability after 22 days CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -1.4780392555858317 [724,565] [184,235,385] -7 hSpCas9 negative selection 4985506
241517282 241517304 1 + 27760321 HT29 viability after 22 days GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.9346899583959791 [79,62] [27,80,20] -6 hSpCas9 negative selection 4985507
241519599 241519621 1 - 27760321 HT29 viability after 22 days TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.32206928490387843 [698,545] [544,592,589] -3 hSpCas9 negative selection 4985508
241511981 241512003 1 + 27760321 HT29 viability after 19 days CATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.21553315036351428 [0,0] [0,0,0] -2 hSpCas9 negative selection 5068967
241512091 241512113 1 - 27760321 HT29 viability after 19 days CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.8100461544445081 [538,420] [263,275,390] -6 hSpCas9 negative selection 5068968
241517218 241517240 1 + 27760321 HT29 viability after 19 days CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -0.44766174456878083 [724,565] [549,305,759] -4 hSpCas9 negative selection 5068969
241517282 241517304 1 + 27760321 HT29 viability after 19 days GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -1.669860785174266 [79,62] [10,49,14] -7 hSpCas9 negative selection 5068970
241519599 241519621 1 - 27760321 HT29 viability after 19 days TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 0.07197500447129834 [698,545] [689,784,762] 0 hSpCas9 negative selection 5068971
241511981 241512003 1 + 27760321 HT29 viability after 16 days CATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.1840686979425925 [0,0] [0,0,0] -2 hSpCas9 negative selection 5152430
241512091 241512113 1 - 27760321 HT29 viability after 16 days CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -0.09570293624571702 [538,420] [463,579,457] -1 hSpCas9 negative selection 5152431
241517218 241517240 1 + 27760321 HT29 viability after 16 days CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -0.11993675690692995 [724,565] [929,462,630] -1 hSpCas9 negative selection 5152432
241517282 241517304 1 + 27760321 HT29 viability after 16 days GTATCATATTCTATCCGGAAGG FH ENSG00000091483 0.11846875925679479 [79,62] [26,124,101] 1 hSpCas9 negative selection 5152433
241519599 241519621 1 - 27760321 HT29 viability after 16 days TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 0.07190166333291359 [698,545] [869,699,639] 0 hSpCas9 negative selection 5152434
241511981 241512003 1 + 27760321 HT29 viability after 13 days CATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.23635609738673047 [0,0] [0,0,0] -3 hSpCas9 negative selection 5235893
241512091 241512113 1 - 27760321 HT29 viability after 13 days CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.1658239590331414 [538,420] [696,605,573] 2 hSpCas9 negative selection 5235894
241517218 241517240 1 + 27760321 HT29 viability after 13 days CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -0.33392629885408287 [724,565] [583,530,662] -4 hSpCas9 negative selection 5235895
241517282 241517304 1 + 27760321 HT29 viability after 13 days GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.3095638226706252 [79,62] [20,61,114] -4 hSpCas9 negative selection 5235896
241519599 241519621 1 - 27760321 HT29 viability after 13 days TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 -0.3162631008925356 [698,545] [657,521,560] -4 hSpCas9 negative selection 5235897
241511981 241512003 1 + 27760321 HT29 viability after 10 days CATGATCGTTGGGATGCACAGG FH ENSG00000091483 -0.34236740454707437 [0,0] [0,0,0] -4 hSpCas9 negative selection 5319356
241512091 241512113 1 - 27760321 HT29 viability after 10 days CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 0.12814165168778235 [538,420] [445,1030,501] 1 hSpCas9 negative selection 5319357
241517218 241517240 1 + 27760321 HT29 viability after 10 days CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 0.09729883141454398 [724,565] [778,890,915] 1 hSpCas9 negative selection 5319358
241517282 241517304 1 + 27760321 HT29 viability after 10 days GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -0.5191366303856828 [79,62] [12,104,69] -6 hSpCas9 negative selection 5319359
241519599 241519621 1 - 27760321 HT29 viability after 10 days TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 0.46831015499540984 [698,545] [1284,1064,879] 6 hSpCas9 negative selection 5319360
241511981 241512003 1 + 27760321 MOLM13 viability CATGATCGTTGGGATGCACAGG FH ENSG00000091483 0.8210053139495912 [0,0] [0,0] 6 hSpCas9 negative selection 5402819
241512091 241512113 1 - 27760321 MOLM13 viability CTCTCGTGGTATGGCAGACTGG FH ENSG00000091483 -4.04448938938083 [607,538] [31,8] -9 hSpCas9 negative selection 5402820
241517218 241517240 1 + 27760321 MOLM13 viability CATCGTAGATCTCACGGTCTGG FH ENSG00000091483 -1.876043564181331 [908,724] [32,202] -7 hSpCas9 negative selection 5402821
241517282 241517304 1 + 27760321 MOLM13 viability GTATCATATTCTATCCGGAAGG FH ENSG00000091483 -5.679782256471421 [102,79] [0,0] -9 hSpCas9 negative selection 5402822
241519599 241519621 1 - 27760321 MOLM13 viability TCGTTTTGGCCTCCGAACGCGG FH ENSG00000091483 0.7567019362858672 [731,698] [285,1020] 5 hSpCas9 negative selection 5402823
241519540 241519563 1 + 27661255 K562 viability GAGGGCTGAAGGTCACTGCGGGG FH ENSG00000091483 -1.2986914410511545 [1481,1380] [513,423] -9 dCas9-KRAB negative selection 5480254
241519702 241519725 1 + 27661255 K562 viability GAGCCGAAGTGCTCGGTACATGG FH ENSG00000091483 -3.237516459877799 [421,568] [51,32] -9 dCas9-KRAB negative selection 5480255
241519735 241519758 1 + 27661255 K562 viability GCTTGGGTAGAATTTCTGGGCGG FH ENSG00000091483 -1.3683910870216698 [752,911] [260,252] -9 dCas9-KRAB negative selection 5480256
241519674 241519697 1 - 27661255 K562 viability GCGCTCGCGTCCCCTCGTGCGGG FH ENSG00000091483 -0.6973619262990303 [321,499] [269,141] -8 dCas9-KRAB negative selection 5480257
241519705 241519728 1 - 27661255 K562 viability GCACCATGTACCGAGCACTTCGG FH ENSG00000091483 -0.6228394496002729 [16,82] [20,28] -8 dCas9-KRAB negative selection 5480258
241512091 241512114 1 + 27260156 BXPC3 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.0025542965386807226 [662] [573,675,769,778] 0 hSpCas9 negative selection 5543619
241513656 241513679 1 - 27260156 BXPC3 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.23400683332301098 [310] [186,291,336,300] -5 hSpCas9 negative selection 5543620
241517212 241517235 1 + 27260156 BXPC3 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.44915436381622187 [386] [318,272,221,376] -7 hSpCas9 negative selection 5543621
241517240 241517263 1 + 27260156 BXPC3 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.1262840786774116 [392] [449,437,531,361] 2 hSpCas9 negative selection 5607884
241511966 241511989 1 - 27260156 BXPC3 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.07641247304939769 [241] [233,200,212,322] -2 hSpCas9 negative selection 5607885
241513691 241513714 1 - 27260156 BXPC3 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.10380434344042896 [464] [481,460,590,566] 2 hSpCas9 negative selection 5607886
241512091 241512114 1 + 27260156 A673 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.013325914103449077 [662] [797,700,842,875] 0 hSpCas9 negative selection 5664870
241513656 241513679 1 - 27260156 A673 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.0189662116705136 [310] [425,321,398,331] 0 hSpCas9 negative selection 5664871
241517212 241517235 1 + 27260156 A673 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.0428630078450154 [386] [444,435,425,498] -1 hSpCas9 negative selection 5664872
241517240 241517263 1 + 27260156 A673 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.08879823712064588 [392] [545,426,353,460] -2 hSpCas9 negative selection 5729135
241511966 241511989 1 - 27260156 A673 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.029417624048792446 [241] [336,275,295,280] 0 hSpCas9 negative selection 5729136
241513691 241513714 1 - 27260156 A673 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.1382568982718437 [464] [512,393,570,555] -3 hSpCas9 negative selection 5729137
241512091 241512114 1 + 27260156 A375 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.5458792451232242 [662] [358,278,219,210] -9 hSpCas9 negative selection 5786121
241513656 241513679 1 - 27260156 A375 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.14289141556991447 [310] [425,270,342,273] -2 hSpCas9 negative selection 5786122
241517212 241517235 1 + 27260156 A375 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -1.1594520030811144 [386] [84,250,187,280] -8 hSpCas9 negative selection 5786123
241517240 241517263 1 + 27260156 A375 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.11926299780171268 [392] [449,571,433,271] -2 hSpCas9 negative selection 5850386
241511966 241511989 1 - 27260156 A375 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.19563037628599778 [241] [220,266,291,212] -3 hSpCas9 negative selection 5850387
241513691 241513714 1 - 27260156 A375 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.05330444424222436 [464] [593,726,502,320] -1 hSpCas9 negative selection 5850388
241512091 241512114 1 + 27260156 COLO741 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.3820913892469223 [662] [918,640,427] -7 hSpCas9 negative selection 5907372
241513656 241513679 1 - 27260156 COLO741 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.19832526751204893 [310] [480,503,388] 4 hSpCas9 negative selection 5907373
241517212 241517235 1 + 27260156 COLO741 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.28769830073395886 [386] [505,371,348] -6 hSpCas9 negative selection 5907374
241517240 241517263 1 + 27260156 COLO741 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.015722040167009288 [392] [439,668,383] 0 hSpCas9 negative selection 5971637
241511966 241511989 1 - 27260156 COLO741 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.3203693837514222 [241] [197,358,185] -6 hSpCas9 negative selection 5971638
241513691 241513714 1 - 27260156 COLO741 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.008756418812453017 [464] [764,460,560] 0 hSpCas9 negative selection 5971639
241512091 241512114 1 + 27260156 CAL120 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.546650653796541 [662] [288,158,397] -9 hSpCas9 negative selection 6028623
241513656 241513679 1 - 27260156 CAL120 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.3706640051120125 [310] [277,449,168] -5 hSpCas9 negative selection 6028624
241517212 241517235 1 + 27260156 CAL120 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -1.7400649126107552 [386] [101,230,93] -9 hSpCas9 negative selection 6028625
241517240 241517263 1 + 27260156 CAL120 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.40936023580975645 [392] [940,396,653] 6 hSpCas9 negative selection 6092888
241511966 241511989 1 - 27260156 CAL120 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.29022791504745726 [241] [262,275,202] -4 hSpCas9 negative selection 6092889
241513691 241513714 1 - 27260156 CAL120 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.12225845059689318 [464] [813,590,513] 1 hSpCas9 negative selection 6092890
241512091 241512114 1 + 27260156 CADOES1 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.4999245786563012 [662] [351,363,571,456] -7 hSpCas9 negative selection 6149874
241513656 241513679 1 - 27260156 CADOES1 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.6448687526778105 [310] [156,257,144,179] -8 hSpCas9 negative selection 6149875
241517212 241517235 1 + 27260156 CADOES1 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.6623767047050194 [386] [210,177,231,290] -8 hSpCas9 negative selection 6149876
241517240 241517263 1 + 27260156 CADOES1 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.2941771304644513 [392] [287,305,284,313] -5 hSpCas9 negative selection 6214139
241511966 241511989 1 - 27260156 CADOES1 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.1742632022628443 [241] [349,253,199,209] 3 hSpCas9 negative selection 6214140
241513691 241513714 1 - 27260156 CADOES1 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.22810492114037825 [464] [337,402,444,287] -4 hSpCas9 negative selection 6214141
241512091 241512114 1 + 27260156 EWS502 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.18004937696871653 [662] [712,560,515,680] -3 hSpCas9 negative selection 6271125
241513656 241513679 1 - 27260156 EWS502 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.5398677452933887 [310] [228,220,234,219] -7 hSpCas9 negative selection 6271126
241517212 241517235 1 + 27260156 EWS502 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.4160755370849405 [386] [229,317,375,313] -6 hSpCas9 negative selection 6271127
241517240 241517263 1 + 27260156 EWS502 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.07664484171042252 [392] [378,375,392,628] 1 hSpCas9 negative selection 6335390
241511966 241511989 1 - 27260156 EWS502 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.25022604418282535 [241] [220,178,237,224] -4 hSpCas9 negative selection 6335391
241513691 241513714 1 - 27260156 EWS502 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.09500592391959713 [464] [467,427,588,636] 1 hSpCas9 negative selection 6335392
241512091 241512114 1 + 27260156 EW8 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.44030228473589744 [662] [479,340,424,340] -7 hSpCas9 negative selection 6392376
241513656 241513679 1 - 27260156 EW8 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.142384005055614 [310] [342,286,231,264] 2 hSpCas9 negative selection 6392377
241517212 241517235 1 + 27260156 EW8 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.6430333591253439 [386] [252,248,140,175] -8 hSpCas9 negative selection 6392378
241517240 241517263 1 + 27260156 EW8 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.17803429638879847 [392] [531,379,220,349] 3 hSpCas9 negative selection 6456641
241511966 241511989 1 - 27260156 EW8 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.19016098347714072 [241] [135,429,121,214] 3 hSpCas9 negative selection 6456642
241513691 241513714 1 - 27260156 EW8 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.05754138939122623 [464] [411,293,406,331] -1 hSpCas9 negative selection 6456643
241512091 241512114 1 + 27260156 CORL105 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.46080831106828113 [662] [479,782,507,468] -7 hSpCas9 negative selection 6513627
241513656 241513679 1 - 27260156 CORL105 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.26567163059938703 [310] [313,370,329,199] -5 hSpCas9 negative selection 6513628
241517212 241517235 1 + 27260156 CORL105 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.6767665436328084 [386] [254,303,319,258] -8 hSpCas9 negative selection 6513629
241517240 241517263 1 + 27260156 CORL105 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.2492856220870336 [392] [412,314,597,257] -4 hSpCas9 negative selection 6577892
241511966 241511989 1 - 27260156 CORL105 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.11748621691401284 [241] [192,243,353,265] -2 hSpCas9 negative selection 6577893
241513691 241513714 1 - 27260156 CORL105 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.030126332496378513 [464] [512,610,624,395] 0 hSpCas9 negative selection 6577894
241512091 241512114 1 + 27260156 HS294T viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.6813672351375805 [662] [123,93,194,245] -7 hSpCas9 negative selection 6634878
241513656 241513679 1 - 27260156 HS294T viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.004178471215622648 [310] [69,73,149,205] 0 hSpCas9 negative selection 6634879
241517212 241517235 1 + 27260156 HS294T viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.3104826879934357 [386] [33,93,145,236] -4 hSpCas9 negative selection 6634880
241517240 241517263 1 + 27260156 HS294T viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.052526176757607124 [392] [95,86,188,287] 0 hSpCas9 negative selection 6699143
241511966 241511989 1 - 27260156 HS294T viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.26188973665621307 [241] [58,137,49,61] -4 hSpCas9 negative selection 6699144
241513691 241513714 1 - 27260156 HS294T viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.6459033625312042 [464] [181,164,619,148] 8 hSpCas9 negative selection 6699145
241512091 241512114 1 + 27260156 HCC44 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.1588975664208547 [662] [242,207,546,386] -9 hSpCas9 negative selection 6756129
241513656 241513679 1 - 27260156 HCC44 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.48029632306451875 [310] [280,148,397,221] -6 hSpCas9 negative selection 6756130
241517212 241517235 1 + 27260156 HCC44 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.45067064629484344 [386] [381,229,372,320] -6 hSpCas9 negative selection 6756131
241517240 241517263 1 + 27260156 HCC44 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.2896747071286942 [392] [367,507,856,480] 5 hSpCas9 negative selection 6820394
241511966 241511989 1 - 27260156 HCC44 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.0003354190614797137 [241] [389,122,296,316] 0 hSpCas9 negative selection 6820395
241513691 241513714 1 - 27260156 HCC44 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.2166769198470925 [464] [588,800,420,567] 3 hSpCas9 negative selection 6820396
241512091 241512114 1 + 27260156 G402 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.31623332983236 [662] [172,182,500,406] -9 hSpCas9 negative selection 6877380
241513656 241513679 1 - 27260156 G402 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.32676409996784783 [310] [528,295,340,720] 4 hSpCas9 negative selection 6877381
241517212 241517235 1 + 27260156 G402 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -1.0432437520997473 [386] [162,106,208,410] -8 hSpCas9 negative selection 6877382
241517240 241517263 1 + 27260156 G402 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.19645356448296594 [392] [555,653,276,707] 2 hSpCas9 negative selection 6941645
241511966 241511989 1 - 27260156 G402 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.0034712199923554454 [241] [514,119,373,199] 0 hSpCas9 negative selection 6941646
241513691 241513714 1 - 27260156 G402 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.35745826132801983 [464] [937,888,331,782] 4 hSpCas9 negative selection 6941647
241512091 241512114 1 + 27260156 L33 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 0.2153423613133243 [662] [836,320,417,790] 5 hSpCas9 negative selection 6998631
241513656 241513679 1 - 27260156 L33 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.006469813020435922 [310] [360,153,138,278] 0 hSpCas9 negative selection 6998632
241517212 241517235 1 + 27260156 L33 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.012180007061496467 [386] [292,156,243,471] 0 hSpCas9 negative selection 6998633
241517240 241517263 1 + 27260156 L33 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.2288716345008326 [392] [403,224,353,328] 5 hSpCas9 negative selection 7062896
241511966 241511989 1 - 27260156 L33 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.0390830147932727 [241] [287,78,127,255] -1 hSpCas9 negative selection 7062897
241513691 241513714 1 - 27260156 L33 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.08593451530753746 [464] [448,151,341,388] -2 hSpCas9 negative selection 7062898
241512091 241512114 1 + 27260156 K562 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -2.03995484354523 [662] [178,143,139,114] -9 hSpCas9 negative selection 7119882
241513656 241513679 1 - 27260156 K562 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.44789872517469487 [310] [465,167,149,60] -5 hSpCas9 negative selection 7119883
241517212 241517235 1 + 27260156 K562 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.5828897641161541 [386] [205,163,199,328] -6 hSpCas9 negative selection 7119884
241517240 241517263 1 + 27260156 K562 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.7329033768494162 [392] [886,434,529,491] 8 hSpCas9 negative selection 7184147
241511966 241511989 1 - 27260156 K562 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.7123834383872021 [241] [494,242,453,233] 8 hSpCas9 negative selection 7184148
241513691 241513714 1 - 27260156 K562 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.12683647441664314 [464] [352,481,342,339] -2 hSpCas9 negative selection 7184149
241512091 241512114 1 + 27260156 HT29 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.35933126503559387 [662] [648,607,718,542] -6 hSpCas9 negative selection 7241133
241513656 241513679 1 - 27260156 HT29 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.28077265062566836 [310] [345,277,339,281] -5 hSpCas9 negative selection 7241134
241517212 241517235 1 + 27260156 HT29 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.3148786952117091 [386] [365,431,393,327] -6 hSpCas9 negative selection 7241135
241517240 241517263 1 + 27260156 HT29 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.31366201617980366 [392] [647,678,719,363] 6 hSpCas9 negative selection 7305398
241511966 241511989 1 - 27260156 HT29 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.18658044111655048 [241] [283,279,357,129] -4 hSpCas9 negative selection 7305399
241513691 241513714 1 - 27260156 HT29 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.05089045648398456 [464] [649,555,724,428] 1 hSpCas9 negative selection 7305400
241512091 241512114 1 + 27260156 MHHES1 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.28189050342819155 [662] [945,785,449,373] -5 hSpCas9 negative selection 7362384
241513656 241513679 1 - 27260156 MHHES1 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.2318702110597889 [310] [370,582,542,201] 4 hSpCas9 negative selection 7362385
241517212 241517235 1 + 27260156 MHHES1 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.30015107652156525 [386] [438,323,314,339] -5 hSpCas9 negative selection 7362386
241517240 241517263 1 + 27260156 MHHES1 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.08840007896635851 [392] [422,499,476,468] 1 hSpCas9 negative selection 7426649
241511966 241511989 1 - 27260156 MHHES1 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.018385836913226372 [241] [264,207,234,360] 0 hSpCas9 negative selection 7426650
241513691 241513714 1 - 27260156 MHHES1 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.008962971736146092 [464] [436,741,451,484] 0 hSpCas9 negative selection 7426651
241512091 241512114 1 + 27260156 MEWO viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.18957386245867214 [662] [505,591,525] -4 hSpCas9 negative selection 7483635
241513656 241513679 1 - 27260156 MEWO viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.09298623395413375 [310] [289,306,329] 2 hSpCas9 negative selection 7483636
241517212 241517235 1 + 27260156 MEWO viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.09036947127870781 [386] [328,342,345] -2 hSpCas9 negative selection 7483637
241517240 241517263 1 + 27260156 MEWO viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.2829937504450422 [392] [385,246,289] -6 hSpCas9 negative selection 7547900
241511966 241511989 1 - 27260156 MEWO viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.22318282418864166 [241] [238,101,249] -5 hSpCas9 negative selection 7547901
241513691 241513714 1 - 27260156 MEWO viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.3016527924244211 [464] [404,325,337] -6 hSpCas9 negative selection 7547902
241512091 241512114 1 + 27260156 LNCAPCLONEFGC viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.9345258856393777 [662] [271,315,398,282] -8 hSpCas9 negative selection 7604886
241513656 241513679 1 - 27260156 LNCAPCLONEFGC viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.27671019044470235 [310] [231,233,252,213] -4 hSpCas9 negative selection 7604887
241517212 241517235 1 + 27260156 LNCAPCLONEFGC viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.7005229169770554 [386] [304,136,274,157] -8 hSpCas9 negative selection 7604888
241517240 241517263 1 + 27260156 LNCAPCLONEFGC viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.001948832238936049 [392] [243,388,457,345] 0 hSpCas9 negative selection 7669151
241511966 241511989 1 - 27260156 LNCAPCLONEFGC viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.1304874706516318 [241] [254,157,195,192] -2 hSpCas9 negative selection 7669152
241513691 241513714 1 - 27260156 LNCAPCLONEFGC viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.12562934027252393 [464] [547,350,490,457] 2 hSpCas9 negative selection 7669153
241512091 241512114 1 + 27260156 PANC0327 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.1467730162337002 [662] [346,130,310,298] -8 hSpCas9 negative selection 7726137
241513656 241513679 1 - 27260156 PANC0327 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.3200376194535296 [310] [106,219,279,268] -5 hSpCas9 negative selection 7726138
241517212 241517235 1 + 27260156 PANC0327 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -1.2470870320283751 [386] [128,105,161,185] -9 hSpCas9 negative selection 7726139
241517240 241517263 1 + 27260156 PANC0327 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.1860131959937484 [392] [263,392,395,524] 2 hSpCas9 negative selection 7790402
241511966 241511989 1 - 27260156 PANC0327 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.045820225386773994 [241] [190,233,119,282] 0 hSpCas9 negative selection 7790403
241513691 241513714 1 - 27260156 PANC0327 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.2569511686109077 [464] [719,366,424,496] 4 hSpCas9 negative selection 7790404
241512091 241512114 1 + 27260156 NCIH2009 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.3869037739781023 [662] [449,406,222] -9 hSpCas9 negative selection 7847388
241513656 241513679 1 - 27260156 NCIH2009 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.501421674544055 [310] [391,258,286] -6 hSpCas9 negative selection 7847389
241517212 241517235 1 + 27260156 NCIH2009 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -1.4886727190405158 [386] [187,234,152] -9 hSpCas9 negative selection 7847390
241517240 241517263 1 + 27260156 NCIH2009 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.3315137132750357 [392] [602,340,398] -4 hSpCas9 negative selection 7911653
241511966 241511989 1 - 27260156 NCIH2009 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.8068394634708019 [241] [259,120,212] -7 hSpCas9 negative selection 7911654
241513691 241513714 1 - 27260156 NCIH2009 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.1272940619368872 [464] [850,409,899] 1 hSpCas9 negative selection 7911655
241512091 241512114 1 + 27260156 NCIH1373 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.8940002014268524 [662] [360,137,197,33] -9 hSpCas9 negative selection 7968639
241513656 241513679 1 - 27260156 NCIH1373 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.3389161950891657 [310] [419,425,404,134] 3 hSpCas9 negative selection 7968640
241517212 241517235 1 + 27260156 NCIH1373 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -1.6751727010223725 [386] [117,188,69,41] -9 hSpCas9 negative selection 7968641
241517240 241517263 1 + 27260156 NCIH1373 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.1851188816694826 [392] [295,372,517,89] -2 hSpCas9 negative selection 8032904
241511966 241511989 1 - 27260156 NCIH1373 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.2779053457906907 [241] [409,166,139,55] -3 hSpCas9 negative selection 8032905
241513691 241513714 1 - 27260156 NCIH1373 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.49923455047115617 [464] [962,719,719,148] 5 hSpCas9 negative selection 8032906
241512091 241512114 1 + 27260156 PATU8902 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -2.0497067162934273 [662] [201,232,187,283] -9 hSpCas9 negative selection 8089890
241513656 241513679 1 - 27260156 PATU8902 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -1.3423689806876946 [310] [294,90,62,270] -8 hSpCas9 negative selection 8089891
241517212 241517235 1 + 27260156 PATU8902 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -2.0262174296683506 [386] [162,239,32,115] -9 hSpCas9 negative selection 8089892
241517240 241517263 1 + 27260156 PATU8902 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -1.1734560996587615 [392] [420,138,219,184] -8 hSpCas9 negative selection 8154155
241511966 241511989 1 - 27260156 PATU8902 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.6764377905815017 [241] [223,208,198,212] -6 hSpCas9 negative selection 8154156
241513691 241513714 1 - 27260156 PATU8902 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.33504807747570675 [464] [1203,800,558,750] 3 hSpCas9 negative selection 8154157
241512091 241512114 1 + 27260156 PANC1 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.8026425507940096 [662] [285,454,291,298] -8 hSpCas9 negative selection 8211141
241513656 241513679 1 - 27260156 PANC1 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.2915293194298425 [310] [280,293,178,141] -5 hSpCas9 negative selection 8211142
241517212 241517235 1 + 27260156 PANC1 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.3785439496316849 [386] [263,309,245,215] -5 hSpCas9 negative selection 8211143
241517240 241517263 1 + 27260156 PANC1 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.23311344686675006 [392] [319,426,506,343] 4 hSpCas9 negative selection 8275406
241511966 241511989 1 - 27260156 PANC1 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.30144460074253143 [241] [83,335,454,179] 5 hSpCas9 negative selection 8275407
241513691 241513714 1 - 27260156 PANC1 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 -0.18424097451304547 [464] [288,511,268,361] -3 hSpCas9 negative selection 8275408
241512091 241512114 1 + 27260156 PANC0813 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -1.523019090200259 [662] [375,217,261,238] -9 hSpCas9 negative selection 8332392
241513656 241513679 1 - 27260156 PANC0813 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 -0.038451639416040684 [310] [451,396,371,217] 0 hSpCas9 negative selection 8332393
241517212 241517235 1 + 27260156 PANC0813 viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -1.001171388101743 [386] [258,300,166,185] -8 hSpCas9 negative selection 8332394
241517240 241517263 1 + 27260156 PANC0813 viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 -0.07318938045324014 [392] [395,488,367,493] -1 hSpCas9 negative selection 8396657
241511966 241511989 1 - 27260156 PANC0813 viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 -0.38423316988818035 [241] [148,166,398,153] -5 hSpCas9 negative selection 8396658
241513691 241513714 1 - 27260156 PANC0813 viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.12993113015305113 [464] [493,587,723,575] 2 hSpCas9 negative selection 8396659
241512091 241512114 1 + 27260156 RDES viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.1471187575169537 [662] [548,717,617,905] -2 hSpCas9 negative selection 8453643
241513656 241513679 1 - 27260156 RDES viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.17709634192082868 [310] [397,313,470,438] 3 hSpCas9 negative selection 8453644
241517212 241517235 1 + 27260156 RDES viability AAAGTTCATCGTAGATCTCACGG FH ENSG00000091483 -0.08271064323076965 [386] [310,410,427,565] -1 hSpCas9 negative selection 8453645
241517240 241517263 1 + 27260156 RDES viability GCGCCATAATACTTATCATTTGG FH ENSG00000091483 0.12431261550717834 [392] [525,379,549,504] 2 hSpCas9 negative selection 8517908
241511966 241511989 1 - 27260156 RDES viability CGATCATGTTAATAAAAGCCAGG FH ENSG00000091483 0.2930493044243373 [241] [300,372,308,379] 5 hSpCas9 negative selection 8517909
241513691 241513714 1 - 27260156 RDES viability ACCCCAGTTATTAAAGCTTTTGG FH ENSG00000091483 0.20185536011311714 [464] [520,602,607,750] 3 hSpCas9 negative selection 8517910
241512091 241512114 1 + 27260156 PC3 viability CCAGTCTGCCATACCACGAGAGG FH ENSG00000091483 -0.4247401350648103 [662] [362,440,845,459] -7 hSpCas9 negative selection 8574894
241513656 241513679 1 - 27260156 PC3 viability AGCGGCCGCTGAAGTAAACCAGG FH ENSG00000091483 0.06474045991140032 [310] [242,308,463,334]