Crispr

Gene Info

  • Species: Human (Homo sapiens)
  • GeneID: 3064
  • Symbol: htt
  • Description: huntingtin
DataSource: http://genomecrispr.dkfz.de/#!/results/htt

Export (tab separated) Export to Excel
Start The end chr strand pubmed cellline condition sequence symbol ensg log2fc rc_initial rc_final effect cas screentype index
3224028 3224051 4 + 26472758 Jiyoye viability GGAGCAAGAGATTCAAGCAATGG HTT ENSG00000197386 2.622188272476724 [13] [64] 9 hSpCas9 negative selection 75341
3132665 3132688 4 + 26472758 Jiyoye viability CAGCAGGTCCCGCTTCCACGTGG HTT ENSG00000197386 0.18261512348671516 [110] [94] 1 hSpCas9 negative selection 75342
3235669 3235692 4 - 26472758 Jiyoye viability CCAGCGATTCTGCATCCAGGCGG HTT ENSG00000197386 -0.49189570964334584 [68] [36] -4 hSpCas9 negative selection 75343
3074961 3074984 4 - 26472758 Jiyoye viability TGAGGAAGCTGAGGAGGCGGCGG HTT ENSG00000197386 -0.1907261749227811 [55] [36] -1 hSpCas9 negative selection 75344
3105365 3105388 4 - 26472758 Jiyoye viability GGGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.09683526089372274 [61] [49] 0 hSpCas9 negative selection 75345
3127339 3127362 4 + 26472758 Jiyoye viability ACATCATCACAGAACAGCCACGG HTT ENSG00000197386 -0.5403571985999909 [215] [111] -4 hSpCas9 negative selection 75346
3130004 3130027 4 + 26472758 Jiyoye viability TCTTCCTGATGAAGCCTCGGAGG HTT ENSG00000197386 -0.7448277119391766 [199] [89] -5 hSpCas9 negative selection 75347
3131684 3131707 4 - 26472758 Jiyoye viability CAGCTGCTCCCACACAGCTGAGG HTT ENSG00000197386 1.2872147574649606 [93] [172] 7 hSpCas9 negative selection 75348
3132609 3132632 4 - 26472758 Jiyoye viability GCAGTGGCTCCTCGAACCTGTGG HTT ENSG00000197386 -0.35962544220109594 [227] [133] -3 hSpCas9 negative selection 75349
3132625 3132648 4 - 26472758 Jiyoye viability GGTCCCACAGAGAATGGCAGTGG HTT ENSG00000197386 -0.7448277119391764 [79] [35] -5 hSpCas9 negative selection 75350
3224028 3224051 4 + 26472758 KBM7 viability GGAGCAAGAGATTCAAGCAATGG HTT ENSG00000197386 -1.2466328666398356 [388,242] [71,51] -7 hSpCas9 negative selection 266459
3132665 3132688 4 + 26472758 KBM7 viability CAGCAGGTCCCGCTTCCACGTGG HTT ENSG00000197386 0.12659284541070576 [642,394] [266,255] 1 hSpCas9 negative selection 266460
3235669 3235692 4 - 26472758 KBM7 viability CCAGCGATTCTGCATCCAGGCGG HTT ENSG00000197386 0.09269825473198579 [341,130] [127,100] 0 hSpCas9 negative selection 266461
3074961 3074984 4 - 26472758 KBM7 viability TGAGGAAGCTGAGGAGGCGGCGG HTT ENSG00000197386 -1.2774254665019145 [207,186] [13,59] -7 hSpCas9 negative selection 266462
3105365 3105388 4 - 26472758 KBM7 viability GGGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 -0.8641535296992666 [477,279] [71,116] -6 hSpCas9 negative selection 266463
3127339 3127362 4 + 26472758 KBM7 viability ACATCATCACAGAACAGCCACGG HTT ENSG00000197386 0.14506435324437694 [640,468] [447,139] 1 hSpCas9 negative selection 266464
3130004 3130027 4 + 26472758 KBM7 viability TCTTCCTGATGAAGCCTCGGAGG HTT ENSG00000197386 0.049477437102356414 [736,616] [298,353] 0 hSpCas9 negative selection 266465
3131684 3131707 4 - 26472758 KBM7 viability CAGCTGCTCCCACACAGCTGAGG HTT ENSG00000197386 1.1555135244896346 [556,461] [631,440] 9 hSpCas9 negative selection 266466
3132609 3132632 4 - 26472758 KBM7 viability GCAGTGGCTCCTCGAACCTGTGG HTT ENSG00000197386 0.0012568275464550638 [849,716] [370,363] 0 hSpCas9 negative selection 266467
3132625 3132648 4 - 26472758 KBM7 viability GGTCCCACAGAGAATGGCAGTGG HTT ENSG00000197386 -1.901515005001033 [430,331] [54,40] -8 hSpCas9 negative selection 266468
3224028 3224051 4 + 26472758 Raji viability GGAGCAAGAGATTCAAGCAATGG HTT ENSG00000197386 0.0004683314570875785 [167] [38] 0 hSpCas9 negative selection 457577
3132665 3132688 4 + 26472758 Raji viability CAGCAGGTCCCGCTTCCACGTGG HTT ENSG00000197386 0.5726067918206601 [225] [77] 5 hSpCas9 negative selection 457578
3235669 3235692 4 - 26472758 Raji viability CCAGCGATTCTGCATCCAGGCGG HTT ENSG00000197386 1.0788143831768287 [101] [49] 8 hSpCas9 negative selection 457579
3074961 3074984 4 - 26472758 Raji viability TGAGGAAGCTGAGGAGGCGGCGG HTT ENSG00000197386 -1.4574010834099265 [141] [11] -7 hSpCas9 negative selection 457580
3105365 3105388 4 - 26472758 Raji viability GGGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.1940951685669301 [112] [29] 1 hSpCas9 negative selection 457581
3127339 3127362 4 + 26472758 Raji viability ACATCATCACAGAACAGCCACGG HTT ENSG00000197386 -0.16563495903281655 [231] [47] -1 hSpCas9 negative selection 457582
3130004 3130027 4 + 26472758 Raji viability TCTTCCTGATGAAGCCTCGGAGG HTT ENSG00000197386 -0.0071024796432865855 [484] [111] 0 hSpCas9 negative selection 457583
3131684 3131707 4 - 26472758 Raji viability CAGCTGCTCCCACACAGCTGAGG HTT ENSG00000197386 0.6639376209090015 [358] [131] 6 hSpCas9 negative selection 457584
3132609 3132632 4 - 26472758 Raji viability GCAGTGGCTCCTCGAACCTGTGG HTT ENSG00000197386 -0.4969442902144877 [449] [73] -4 hSpCas9 negative selection 457585
3132625 3132648 4 - 26472758 Raji viability GGTCCCACAGAGAATGGCAGTGG HTT ENSG00000197386 -0.9265637965497382 [171] [20] -6 hSpCas9 negative selection 457586
3224028 3224051 4 + 26472758 K562 viability GGAGCAAGAGATTCAAGCAATGG HTT ENSG00000197386 1.9078735367069024 [154] [490] 9 hSpCas9 negative selection 648695
3132665 3132688 4 + 26472758 K562 viability CAGCAGGTCCCGCTTCCACGTGG HTT ENSG00000197386 1.0899848079666348 [329] [592] 8 hSpCas9 negative selection 648696
3235669 3235692 4 - 26472758 K562 viability CCAGCGATTCTGCATCCAGGCGG HTT ENSG00000197386 -0.13021641755175972 [222] [171] -1 hSpCas9 negative selection 648697
3074961 3074984 4 - 26472758 K562 viability TGAGGAAGCTGAGGAGGCGGCGG HTT ENSG00000197386 -1.0266084689208776 [180] [74] -5 hSpCas9 negative selection 648698
3105365 3105388 4 - 26472758 K562 viability GGGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 -0.43228634168228475 [210] [131] -3 hSpCas9 negative selection 648699
3127339 3127362 4 + 26472758 K562 viability ACATCATCACAGAACAGCCACGG HTT ENSG00000197386 1.2145172419525851 [389] [763] 8 hSpCas9 negative selection 648700
3130004 3130027 4 + 26472758 K562 viability TCTTCCTGATGAAGCCTCGGAGG HTT ENSG00000197386 0.5633063682337581 [569] [710] 4 hSpCas9 negative selection 648701
3131684 3131707 4 - 26472758 K562 viability CAGCTGCTCCCACACAGCTGAGG HTT ENSG00000197386 1.0668245053295369 [612] [1083] 8 hSpCas9 negative selection 648702
3132609 3132632 4 - 26472758 K562 viability GCAGTGGCTCCTCGAACCTGTGG HTT ENSG00000197386 0.06754096558236766 [597] [528] 0 hSpCas9 negative selection 648703
3132625 3132648 4 - 26472758 K562 viability GGTCCCACAGAGAATGGCAGTGG HTT ENSG00000197386 0.5209996653381884 [264] [320] 4 hSpCas9 negative selection 648704
3099340 3099363 4 + 26627737 DLD1 viability CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.43032320992726725 [811] [226,186,155] -4 hSpCas9 negative selection 824939
3105386 3105409 4 - 26627737 DLD1 viability CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.7862783830112714 [901] [158,140,185] -6 hSpCas9 negative selection 824940
3107291 3107314 4 - 26627737 DLD1 viability GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 2.2609908461690056 [35] [86,40,35] 9 hSpCas9 negative selection 824941
3115349 3115372 4 + 26627737 DLD1 viability ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 -0.9190258295294715 [388] [102,57,35] -7 hSpCas9 negative selection 824944
3116199 3116222 4 + 26627737 DLD1 viability AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 -0.9342401278351385 [282] [7,128,10] -7 hSpCas9 negative selection 824945
3121365 3121388 4 + 26627737 DLD1 viability GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 0.15935204632840028 [213] [86,110,33] 1 hSpCas9 negative selection 824946
3099340 3099363 4 + 26627737 GBM cells viability after 5 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.04611966589638583 [514] [241,292] 0 hSpCas9 negative selection 907254
3105386 3105409 4 - 26627737 GBM cells viability after 5 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.004301062579434856 [489] [195,327] 0 hSpCas9 negative selection 907255
3107291 3107314 4 - 26627737 GBM cells viability after 5 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -0.8975527310291822 [32] [8,9] -8 hSpCas9 negative selection 907256
3115349 3115372 4 + 26627737 GBM cells viability after 5 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 0.5354066762469237 [109] [65,104] 7 hSpCas9 negative selection 907259
3116199 3116222 4 + 26627737 GBM cells viability after 5 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 0.16968392949908462 [154] [100,85] 2 hSpCas9 negative selection 907260
3121365 3121388 4 + 26627737 GBM cells viability after 5 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 0.09921252537151659 [93] [48,58] 1 hSpCas9 negative selection 907261
3099340 3099363 4 + 26627737 GBM cells viability after 13 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.8607793930652423 [514] [165,143] -7 hSpCas9 negative selection 989569
3105386 3105409 4 - 26627737 GBM cells viability after 13 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.49375243846725175 [489] [222,160] -5 hSpCas9 negative selection 989570
3107291 3107314 4 - 26627737 GBM cells viability after 13 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -3.5286546483231596 [32] [0,1] -9 hSpCas9 negative selection 989571
3115349 3115372 4 + 26627737 GBM cells viability after 13 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 0.07633853242693767 [109] [52,70] 1 hSpCas9 negative selection 989574
3116199 3116222 4 + 26627737 GBM cells viability after 13 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 -0.17030346289277454 [154] [98,54] -2 hSpCas9 negative selection 989575
3121365 3121388 4 + 26627737 GBM cells viability after 13 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 0.7162913369743218 [93] [85,81] 8 hSpCas9 negative selection 989576
3099340 3099363 4 + 26627737 GBM cells viability after 21 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.4922152657736154 [514] [200,196] -4 hSpCas9 negative selection 1071884
3105386 3105409 4 - 26627737 GBM cells viability after 21 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -1.208407732831962 [489] [133,97] -7 hSpCas9 negative selection 1071885
3107291 3107314 4 - 26627737 GBM cells viability after 21 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -0.365995069139851 [32] [15,11] -3 hSpCas9 negative selection 1071886
3115349 3115372 4 + 26627737 GBM cells viability after 21 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 0.1723606169697789 [109] [70,63] 1 hSpCas9 negative selection 1071889
3116199 3116222 4 + 26627737 GBM cells viability after 21 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 0.06990201323015632 [154] [90,85] 0 hSpCas9 negative selection 1071890
3121365 3121388 4 + 26627737 GBM cells viability after 21 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 -0.07114134678460005 [93] [45,50] 0 hSpCas9 negative selection 1071891
3099340 3099363 4 + 26627737 RPE1 viability after 9 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 1.8369116131099794 [575] [624,668] 8 hSpCas9 negative selection 1154199
3105386 3105409 4 - 26627737 RPE1 viability after 9 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.12779901920071696 [910] [119,442] -1 hSpCas9 negative selection 1154200
3107291 3107314 4 - 26627737 RPE1 viability after 9 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 1.5142194533549191 [68] [7,130] 8 hSpCas9 negative selection 1154201
3115349 3115372 4 + 26627737 RPE1 viability after 9 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 1.2074469740661735 [244] [84,295] 7 hSpCas9 negative selection 1154204
3116199 3116222 4 + 26627737 RPE1 viability after 9 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 0.6603756865253224 [533] [189,359] 4 hSpCas9 negative selection 1154205
3121365 3121388 4 + 26627737 RPE1 viability after 9 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.7355024359271995 [222] [221,245] 8 hSpCas9 negative selection 1154206
3099340 3099363 4 + 26627737 RPE1 viability after 12 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 1.9153755916756015 [575] [472,700] 8 hSpCas9 negative selection 1236514
3105386 3105409 4 - 26627737 RPE1 viability after 12 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 0.5445844319001868 [910] [237,482] 3 hSpCas9 negative selection 1236515
3107291 3107314 4 - 26627737 RPE1 viability after 12 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 2.0409279645249185 [68] [0,155] 8 hSpCas9 negative selection 1236516
3115349 3115372 4 + 26627737 RPE1 viability after 12 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 1.566803786420178 [244] [211,176] 8 hSpCas9 negative selection 1236519
3116199 3116222 4 + 26627737 RPE1 viability after 12 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 1.1206855778677602 [533] [327,294] 6 hSpCas9 negative selection 1236520
3121365 3121388 4 + 26627737 RPE1 viability after 12 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.5511257900678908 [222] [160,190] 8 hSpCas9 negative selection 1236521
3099340 3099363 4 + 26627737 RPE1 viability after 15 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 1.9712558971099958 [575] [672,605] 8 hSpCas9 negative selection 1318829
3105386 3105409 4 - 26627737 RPE1 viability after 15 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 0.3702708117816572 [910] [270,392] 2 hSpCas9 negative selection 1318830
3107291 3107314 4 - 26627737 RPE1 viability after 15 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 1.7499326074885762 [68] [0,127] 8 hSpCas9 negative selection 1318831
3115349 3115372 4 + 26627737 RPE1 viability after 15 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 1.737015397243344 [244] [313,150] 8 hSpCas9 negative selection 1318834
3116199 3116222 4 + 26627737 RPE1 viability after 15 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 1.0317129466088675 [533] [205,407] 6 hSpCas9 negative selection 1318835
3121365 3121388 4 + 26627737 RPE1 viability after 15 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.748523066656115 [222] [213,209] 8 hSpCas9 negative selection 1318836
3099340 3099363 4 + 26627737 RPE1 viability after 18 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 2.1069949583767213 [575] [498,851] 8 hSpCas9 negative selection 1401144
3105386 3105409 4 - 26627737 RPE1 viability after 18 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 0.4502510371958226 [910] [128,556] 3 hSpCas9 negative selection 1401145
3107291 3107314 4 - 26627737 RPE1 viability after 18 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 2.291490823799366 [68] [22,163] 9 hSpCas9 negative selection 1401146
3115349 3115372 4 + 26627737 RPE1 viability after 18 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 2.0890859947567804 [244] [275,286] 8 hSpCas9 negative selection 1401149
3116199 3116222 4 + 26627737 RPE1 viability after 18 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 1.3842520302275705 [533] [293,463] 7 hSpCas9 negative selection 1401150
3121365 3121388 4 + 26627737 RPE1 viability after 18 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.803795085414526 [222] [227,190] 8 hSpCas9 negative selection 1401151
3099340 3099363 4 + 26627737 HeLa viability after 8 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 0.013260877014122485 [972] [223,568,442] 0 hSpCas9 negative selection 1483459
3105386 3105409 4 - 26627737 HeLa viability after 8 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 0.19137864861646625 [786] [452,331,400] 1 hSpCas9 negative selection 1483460
3107291 3107314 4 - 26627737 HeLa viability after 8 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 0.13779900692388414 [138] [53,92,50] 1 hSpCas9 negative selection 1483461
3115349 3115372 4 + 26627737 HeLa viability after 8 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 0.7802052224742814 [159] [201,27,144] 6 hSpCas9 negative selection 1483464
3116199 3116222 4 + 26627737 HeLa viability after 8 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 -0.8698048389225197 [320] [138,70,35] -7 hSpCas9 negative selection 1483465
3121365 3121388 4 + 26627737 HeLa viability after 8 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.5180103065928996 [66] [133,49,77] 9 hSpCas9 negative selection 1483466
3099340 3099363 4 + 26627737 HeLa viability after 12 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.13134435280737944 [972] [371,333,398] -1 hSpCas9 negative selection 1565774
3105386 3105409 4 - 26627737 HeLa viability after 12 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.4820133004707553 [786] [247,185,269] -4 hSpCas9 negative selection 1565775
3107291 3107314 4 - 26627737 HeLa viability after 12 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -5.844082945522194 [138] [0,0,0] -9 hSpCas9 negative selection 1565776
3115349 3115372 4 + 26627737 HeLa viability after 12 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 1.0324126470709938 [159] [44,277,64] 7 hSpCas9 negative selection 1565779
3116199 3116222 4 + 26627737 HeLa viability after 12 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 -1.1635154435402693 [320] [81,33,64] -8 hSpCas9 negative selection 1565780
3121365 3121388 4 + 26627737 HeLa viability after 12 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.9108223092138577 [66] [72,79,160] 9 hSpCas9 negative selection 1565781
3099340 3099363 4 + 26627737 HeLa viability after 15 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 0.02022696999660245 [972] [346,466,390] 0 hSpCas9 negative selection 1648089
3105386 3105409 4 - 26627737 HeLa viability after 15 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.2364919258155016 [786] [399,204,203] -2 hSpCas9 negative selection 1648090
3107291 3107314 4 - 26627737 HeLa viability after 15 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -1.1030847209017205 [138] [56,14,4] -7 hSpCas9 negative selection 1648091
3115349 3115372 4 + 26627737 HeLa viability after 15 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 0.6557054550351522 [159] [55,118,135] 5 hSpCas9 negative selection 1648094
3116199 3116222 4 + 26627737 HeLa viability after 15 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 -0.9099770807624272 [320] [110,52,41] -7 hSpCas9 negative selection 1648095
3121365 3121388 4 + 26627737 HeLa viability after 15 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.8480323819456332 [66] [80,64,152] 9 hSpCas9 negative selection 1648096
3099340 3099363 4 + 26627737 HeLa viability after 18 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 0.006543361957426663 [972] [221,390,390] 0 hSpCas9 negative selection 1730404
3105386 3105409 4 - 26627737 HeLa viability after 18 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.23100217410920487 [786] [270,168,203] -2 hSpCas9 negative selection 1730405
3107291 3107314 4 - 26627737 HeLa viability after 18 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -1.1836039973988246 [138] [34,12,4] -8 hSpCas9 negative selection 1730406
3115349 3115372 4 + 26627737 HeLa viability after 18 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 0.7012220328899841 [159] [41,100,135] 5 hSpCas9 negative selection 1730409
3116199 3116222 4 + 26627737 HeLa viability after 18 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 -0.9098245819467772 [320] [71,46,41] -7 hSpCas9 negative selection 1730410
3121365 3121388 4 + 26627737 HeLa viability after 18 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 1.7925533665380278 [66] [46,53,152] 9 hSpCas9 negative selection 1730411
3099340 3099363 4 + 26627737 HCT116 viability after 6 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 0.40631464624783986 [1077] [513,64] 2 hSpCas9 negative selection 1812719
3105386 3105409 4 - 26627737 HCT116 viability after 6 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 1.1740185644691592 [1215] [246,532] 6 hSpCas9 negative selection 1812720
3107291 3107314 4 - 26627737 HCT116 viability after 6 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 2.244886126629231 [47] [96,1] 9 hSpCas9 negative selection 1812721
3115349 3115372 4 + 26627737 HCT116 viability after 6 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 1.4641569732643762 [425] [80,241] 7 hSpCas9 negative selection 1812724
3116199 3116222 4 + 26627737 HCT116 viability after 6 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 -1.0913542505626799 [383] [37,22] -6 hSpCas9 negative selection 1812725
3121365 3121388 4 + 26627737 HCT116 viability after 6 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 -4.544668591404613 [253] [2,0] -9 hSpCas9 negative selection 1812726
3099340 3099363 4 + 26627737 HCT116 viability after 8 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.1832102415769652 [843] [377,337,510] -2 hSpCas9 negative selection 1895034
3105386 3105409 4 - 26627737 HCT116 viability after 8 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.41788615813431285 [572] [226,175,304] -5 hSpCas9 negative selection 1895035
3107291 3107314 4 - 26627737 HCT116 viability after 8 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -0.40161218991793346 [70] [38,18,30] -5 hSpCas9 negative selection 1895036
3115349 3115372 4 + 26627737 HCT116 viability after 8 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 -0.5134468176840468 [295] [133,165,43] -6 hSpCas9 negative selection 1895039
3116199 3116222 4 + 26627737 HCT116 viability after 8 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 0.4061687234947615 [201] [114,185,140] 4 hSpCas9 negative selection 1895040
3121365 3121388 4 + 26627737 HCT116 viability after 8 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 0.09600026070017531 [134] [94,80,62] 1 hSpCas9 negative selection 1895041
3099340 3099363 4 + 26627737 HCT116 viability after 9 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 0.03356784879579888 [1077] [364,238] 0 hSpCas9 negative selection 1977349
3105386 3105409 4 - 26627737 HCT116 viability after 9 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 0.07137613584121782 [1215] [310,364] 0 hSpCas9 negative selection 1977350
3107291 3107314 4 - 26627737 HCT116 viability after 9 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 3.7376517855207565 [47] [175,166] 9 hSpCas9 negative selection 1977351
3115349 3115372 4 + 26627737 HCT116 viability after 9 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 0.4187206628133805 [425] [327,12] 3 hSpCas9 negative selection 1977354
3116199 3116222 4 + 26627737 HCT116 viability after 9 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 1.9818695909401622 [383] [70,668] 9 hSpCas9 negative selection 1977355
3121365 3121388 4 + 26627737 HCT116 viability after 9 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 -2.9712201461602854 [253] [11,5] -9 hSpCas9 negative selection 1977356
3099340 3099363 4 + 26627737 HCT116 viability after 12 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.7066028591838636 [843] [316,296,197] -6 hSpCas9 negative selection 2059664
3105386 3105409 4 - 26627737 HCT116 viability after 12 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.6011008142388128 [572] [152,216,229] -6 hSpCas9 negative selection 2059665
3107291 3107314 4 - 26627737 HCT116 viability after 12 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -0.2713281449530669 [70] [69,17,0] -3 hSpCas9 negative selection 2059666
3115349 3115372 4 + 26627737 HCT116 viability after 12 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 -0.6905661384529762 [295] [77,105,106] -6 hSpCas9 negative selection 2059669
3116199 3116222 4 + 26627737 HCT116 viability after 12 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 0.23460386019155927 [201] [72,113,191] 2 hSpCas9 negative selection 2059670
3121365 3121388 4 + 26627737 HCT116 viability after 12 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 0.2542190638718319 [134] [52,99,103] 2 hSpCas9 negative selection 2059671
3099340 3099363 4 + 26627737 HCT116 viability after 15 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.924080696902972 [843] [349,267,160] -7 hSpCas9 negative selection 2141979
3105386 3105409 4 - 26627737 HCT116 viability after 15 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.32987534774072946 [572] [265,179,338] -3 hSpCas9 negative selection 2141980
3107291 3107314 4 - 26627737 HCT116 viability after 15 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 0.19262688809224016 [70] [142,0,7] 2 hSpCas9 negative selection 2141981
3115349 3115372 4 + 26627737 HCT116 viability after 15 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 -0.33932786396025083 [295] [84,170,140] -4 hSpCas9 negative selection 2141984
3116199 3116222 4 + 26627737 HCT116 viability after 15 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 0.44625673865942905 [201] [171,72,229] 4 hSpCas9 negative selection 2141985
3121365 3121388 4 + 26627737 HCT116 viability after 15 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 0.5003536996521966 [134] [105,65,155] 5 hSpCas9 negative selection 2141986
3099340 3099363 4 + 26627737 HCT116 viability after 18 days CGCAGAGTCAGATGTCAGGATGG HTT ENSG00000197386 -0.6499947550704027 [843] [367,207,204] -5 hSpCas9 negative selection 2224294
3105386 3105409 4 - 26627737 HCT116 viability after 18 days CCAGCTCAGCAAACCTCCACAGG HTT ENSG00000197386 -0.2358976400878675 [572] [258,102,357] -2 hSpCas9 negative selection 2224295
3107291 3107314 4 - 26627737 HCT116 viability after 18 days GGCACGGCAGAAGGTTCACCAGG HTT ENSG00000197386 -0.6880294600366583 [70] [35,5,22] -6 hSpCas9 negative selection 2224296
3115349 3115372 4 + 26627737 HCT116 viability after 18 days ACCATTCGGCGGACAGCGGCTGG HTT ENSG00000197386 -1.0512007970411072 [295] [81,107,11] -7 hSpCas9 negative selection 2224299
3116199 3116222 4 + 26627737 HCT116 viability after 18 days AAGGCAGCTTCGGAGTGACAAGG HTT ENSG00000197386 0.47617224782106354 [201] [111,115,182] 4 hSpCas9 negative selection 2224300
3121365 3121388 4 + 26627737 HCT116 viability after 18 days GCAGCTCACCGCTGCTAAGGAGG HTT ENSG00000197386 0.4734607583732159 [134] [124,40,109] 4 hSpCas9 negative selection 2224301
3074816 3074839 4 + 24336569 HL60 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.3080620724092764 [541] [1419] 3 hSpCas9 negative selection 2271040
3074854 3074877 4 - 24336569 HL60 viability GAAGGACTTGAGGGACTCGAAGG HTT ENSG00000197386 0.0176090965465594 [1455] [3118] 0 hSpCas9 negative selection 2271041
3074863 3074886 4 - 24336569 HL60 viability CTGCTGCTGGAAGGACTTGAGGG HTT ENSG00000197386 -0.27624751291813043 [1060] [1853] -2 hSpCas9 negative selection 2271042
3074872 3074895 4 - 24336569 HL60 viability CTGCTGCTGCTGCTGCTGGAAGG HTT ENSG00000197386 0.306760567515981 [352] [923] 3 hSpCas9 negative selection 2271043
3074961 3074984 4 - 24336569 HL60 viability TGAGGAAGCTGAGGAGGCGGCGG HTT ENSG00000197386 -1.0400441732489152 [411] [423] -7 hSpCas9 negative selection 2271044
3074967 3074990 4 - 24336569 HL60 viability GGCGGCTGAGGAAGCTGAGGAGG HTT ENSG00000197386 -3.163926260820869 [719] [169] -9 hSpCas9 negative selection 2271045
3074975 3074998 4 + 24336569 HL60 viability GCTTCCTCAGCCGCCGCCGCAGG HTT ENSG00000197386 0.6327814170372265 [287] [944] 5 hSpCas9 negative selection 2271046
3074985 3075008 4 - 24336569 HL60 viability AGCGGCTGTGCCTGCGGCGGCGG HTT ENSG00000197386 0.2540105260964139 [423] [1069] 2 hSpCas9 negative selection 2271047
3074991 3075014 4 - 24336569 HL60 viability GGCAGCAGCGGCTGTGCCTGCGG HTT ENSG00000197386 0.3436892642632977 [603] [1621] 3 hSpCas9 negative selection 2271048
3075003 3075026 4 - 24336569 HL60 viability GGCTGCGGCTGAGGCAGCAGCGG HTT ENSG00000197386 -0.48396724616396614 [190] [288] -4 hSpCas9 negative selection 2271049
3074816 3074839 4 + 24336569 KBM7 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 1.1093689280026768 [207] [1223] 8 hSpCas9 negative selection 2338217
3074854 3074877 4 - 24336569 KBM7 viability GAAGGACTTGAGGGACTCGAAGG HTT ENSG00000197386 -0.20153550714778912 [1209] [2869] -2 hSpCas9 negative selection 2338218
3074863 3074886 4 - 24336569 KBM7 viability CTGCTGCTGGAAGGACTTGAGGG HTT ENSG00000197386 1.4008854341278134 [256] [1850] 9 hSpCas9 negative selection 2338219
3074872 3074895 4 - 24336569 KBM7 viability CTGCTGCTGCTGCTGCTGGAAGG HTT ENSG00000197386 -1.4435549399900878 [357] [358] -7 hSpCas9 negative selection 2338220
3074961 3074984 4 - 24336569 KBM7 viability TGAGGAAGCTGAGGAGGCGGCGG HTT ENSG00000197386 -1.273374467729334 [373] [421] -7 hSpCas9 negative selection 2338221
3074967 3074990 4 - 24336569 KBM7 viability GGCGGCTGAGGAAGCTGAGGAGG HTT ENSG00000197386 -2.805727479348998 [604] [235] -9 hSpCas9 negative selection 2338222
3074975 3074998 4 + 24336569 KBM7 viability GCTTCCTCAGCCGCCGCCGCAGG HTT ENSG00000197386 -0.8284358488307629 [430] [661] -6 hSpCas9 negative selection 2338223
3074985 3075008 4 - 24336569 KBM7 viability AGCGGCTGTGCCTGCGGCGGCGG HTT ENSG00000197386 1.2528605215922095 [309] [2014] 8 hSpCas9 negative selection 2338224
3074991 3075014 4 - 24336569 KBM7 viability GGCAGCAGCGGCTGTGCCTGCGG HTT ENSG00000197386 0.3840111124539193 [564] [2010] 3 hSpCas9 negative selection 2338225
3075003 3075026 4 - 24336569 KBM7 viability GGCTGCGGCTGAGGCAGCAGCGG HTT ENSG00000197386 -0.5565135681020467 [274] [509] -4 hSpCas9 negative selection 2338226
3093940 3093963 4 + 25494202 A375 resistance to PLX-4720 (puromycin) GATCATTCTTGGGTGTTTCTTGG HTT ENSG00000197386 -1.4604244820040901 [342,170] [18,21] -8 dCas9-VP64 positive selection 2385508
3103396 3103419 4 + 25494202 A375 resistance to PLX-4720 (puromycin) TGTATTTTTTAGTAGAGACGGAG HTT ENSG00000197386 1.1426357441402555 [202,199] [99,94] 4 dCas9-VP64 positive selection 2404482
3211179 3211202 4 + 25494202 A375 resistance to PLX-4720 (puromycin) TAGGCCTGAGCCACCACGCCCGG HTT ENSG00000197386 3.4338349531393177 [26,8] [73,8] 9 dCas9-VP64 positive selection 2452774
3080118 3080141 4 + 25494202 A375 resistance to PLX-4720 (puromycin) GAGTTTCGCTCTTGTCACCCGGG HTT ENSG00000197386 0.7275722083534555 [14,18] [4,6] 3 dCas9-VP64 positive selection 2454158
3201434 3201457 4 + 25494202 A375 resistance to PLX-4720 (puromycin) GCGGGAGAATCGCTTGAACCTAG HTT ENSG00000197386 -0.7872021050505377 [82,16] [7,2] -4 dCas9-VP64 positive selection 2464219
3085251 3085274 4 - 25494202 A375 resistance to PLX-4720 (puromycin) CCCAGCTACTCGGGAGGCTGCGG HTT ENSG00000197386 -0.4892893999709095 [44,388] [14,54] -2 dCas9-VP64 positive selection 2465856
3113575 3113598 4 - 25494202 A375 resistance to PLX-4720 (puromycin) AGCACTTTGGGAGGCTGAAGAAG HTT ENSG00000197386 6.35516198632701 [126,1064] [8429,13566] 9 dCas9-VP64 positive selection 2467018
3155650 3155673 4 + 25494202 A375 resistance to PLX-4720 (puromycin) GGTGGGCGGATCACGAGGTCGGG HTT ENSG00000197386 2.37985785728498 [230,76] [300,38] 7 dCas9-VP64 positive selection 2475718
3093940 3093963 4 + 25494202 A375 resistance to PLX-4720 (zeocin) GATCATTCTTGGGTGTTTCTTGG HTT ENSG00000197386 0.05140108842447888 [543,205] [120,133] 0 dCas9-VP64 positive selection 2480763
3103396 3103419 4 + 25494202 A375 resistance to PLX-4720 (zeocin) TGTATTTTTTAGTAGAGACGGAG HTT ENSG00000197386 0.25343284215860473 [158,136] [77,37] 2 dCas9-VP64 positive selection 2499737
3211179 3211202 4 + 25494202 A375 resistance to PLX-4720 (zeocin) TAGGCCTGAGCCACCACGCCCGG HTT ENSG00000197386 0.4025668265088169 [39,71] [26,20] 3 dCas9-VP64 positive selection 2548029
3080118 3080141 4 + 25494202 A375 resistance to PLX-4720 (zeocin) GAGTTTCGCTCTTGTCACCCGGG HTT ENSG00000197386 0.3552301064276102 [39,27] [14,12] 3 dCas9-VP64 positive selection 2549413
3201434 3201457 4 + 25494202 A375 resistance to PLX-4720 (zeocin) GCGGGAGAATCGCTTGAACCTAG HTT ENSG00000197386 -0.42856361530074616 [34,35] [8,6] -4 dCas9-VP64 positive selection 2559474
3085251 3085274 4 - 25494202 A375 resistance to PLX-4720 (zeocin) CCCAGCTACTCGGGAGGCTGCGG HTT ENSG00000197386 -0.16148281958930955 [134,276] [52,65] -1 dCas9-VP64 positive selection 2561111
3113575 3113598 4 - 25494202 A375 resistance to PLX-4720 (zeocin) AGCACTTTGGGAGGCTGAAGAAG HTT ENSG00000197386 6.970706058095935 [220,255] [14367,5508] 9 dCas9-VP64 positive selection 2562273
3155650 3155673 4 + 25494202 A375 resistance to PLX-4720 (zeocin) GGTGGGCGGATCACGAGGTCGGG HTT ENSG00000197386 0.17249846111827716 [159,84] [44,44] 1 dCas9-VP64 positive selection 2570973
3127264 3127287 4 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity ACTGATCTCATCCTTCACTGAGG HTT ENSG00000197386 0.19271246964769262 [4,4] [6,2] 4 hSpCas9 positive selection 2994547
3105385 3105408 4 - 27453484 HT29 resistance to T3SS1-dependent cytotoxicity CAGCTCAGCAAACCTCCACAGGG HTT ENSG00000197386 -0.5693301965139925 [4,3] [0,3] -7 hSpCas9 positive selection 2994548
3127544 3127567 4 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GCTCCCAGACCACCACCGAAGGG HTT ENSG00000197386 0.19254995915426937 [3,4] [3,3] 4 hSpCas9 positive selection 2994549
3136274 3136297 4 + 27453484 HT29 resistance to T3SS1-dependent cytotoxicity GCTTGGAGATGAAGACCCCAGGG HTT ENSG00000197386 -0.2039278028469945 [4,4] [2,3] -3 hSpCas9 positive selection 2994550
3127264 3127287 4 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity ACTGATCTCATCCTTCACTGAGG HTT ENSG00000197386 0.10599504339549659 [4,4] [3,2] 1 hSpCas9 positive selection 3062405
3105385 3105408 4 - 27453484 HT29 resistance to T3SS2-dependent cytotoxicity CAGCTCAGCAAACCTCCACAGGG HTT ENSG00000197386 -0.689108181148236 [4,4] [0,2] -8 hSpCas9 positive selection 3062406
3127544 3127567 4 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GCTCCCAGACCACCACCGAAGGG HTT ENSG00000197386 -0.4956359695024719 [3,3] [2,0] -7 hSpCas9 positive selection 3062407
3136274 3136297 4 + 27453484 HT29 resistance to T3SS2-dependent cytotoxicity GCTTGGAGATGAAGACCCCAGGG HTT ENSG00000197386 -0.029117343045623523 [4,4] [3,2] 0 hSpCas9 positive selection 3062408
3075075 3075098 - 24336571 A375 resistance to PLX after 7 days CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.23627483005514427 [4,6] [4,4] -7 hSpCas9 positive selection 3120134
3086987 3087010 + 24336571 A375 resistance to PLX after 7 days GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 0.5558993733379707 [3,3] [5,4] 9 hSpCas9 positive selection 3120135
3086969 3086992 - 24336571 A375 resistance to PLX after 7 days TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.005415966835036794 [10,14] [12,11] 0 hSpCas9 positive selection 3120136
3075075 3075098 - 24336571 A375 resistance to PLX after 14 days CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.44379841243069895 [5,8] [1,1] -5 hSpCas9 positive selection 3177927
3086987 3087010 + 24336571 A375 resistance to PLX after 14 days GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 1.0034347892787139 [1,3] [2,2] 7 hSpCas9 positive selection 3177928
3086969 3086992 - 24336571 A375 resistance to PLX after 14 days TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.18631241666225534 [12,11] [4,3] -2 hSpCas9 positive selection 3177929
3075075 3075098 - 24336571 A375 viability after 7 days CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.3966888990445884 [7] [4,6] -5 hSpCas9 negative selection 3235720
3086987 3087010 + 24336571 A375 viability after 7 days GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -1.165138672269431 [9] [3,3] -9 hSpCas9 negative selection 3235721
3086969 3086992 - 24336571 A375 viability after 7 days TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.2122798306742987 [15] [10,14] -3 hSpCas9 negative selection 3235722
3075075 3075098 - 24336571 A375 viability after 14 days CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.06257110683337896 [7] [5,8] 0 hSpCas9 negative selection 3293513
3086987 3087010 + 24336571 A375 viability after 14 days GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -1.4721124597399469 [9] [1,3] -9 hSpCas9 negative selection 3293514
3086969 3086992 - 24336571 A375 viability after 14 days TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.21091102905929893 [15] [12,11] -2 hSpCas9 negative selection 3293515
3086969 3086992 4 - 27383988 293T resistance to West Nile virus (flavivirus) TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.49756129071763344 [215,215] [0,0] -3 hSpCas9 positive selection 3373561
3086987 3087010 4 + 27383988 293T resistance to West Nile virus (flavivirus) GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 2.7978945928085377 [21,21] [0,0] 8 hSpCas9 positive selection 3373562
3099281 3099304 4 - 27383988 293T resistance to West Nile virus (flavivirus) CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.6723637107246789 [95,95] [0,0] 3 hSpCas9 positive selection 3373563
3127264 3127287 4 - 26780180 HT29 viability (Avana library 4 designs) ACTGATCTCATCCTTCACTGAGG HTT ENSG00000197386 1.0421558403476 [] [] 4 hSpCas9 negative selection 3431881
3105385 3105408 4 - 26780180 HT29 viability (Avana library 4 designs) CAGCTCAGCAAACCTCCACAGGG HTT ENSG00000197386 3.89834284063145 [] [] 9 hSpCas9 negative selection 3431882
3127543 3127566 4 + 26780180 HT29 viability (Avana library 4 designs) GCTCCCAGACCACCACCGAAGGG HTT ENSG00000197386 1.0156367981324 [] [] 4 hSpCas9 negative selection 3431883
3136273 3136296 4 + 26780180 HT29 viability (Avana library 4 designs) GCTTGGAGATGAAGACCCCAGGG HTT ENSG00000197386 3.3247207826662 [] [] 8 hSpCas9 negative selection 3431884
3127543 3127566 4 + 26780180 A375 viability (Avana lentiCRISPRv2) GCTCCCAGACCACCACCGAAGGG HTT ENSG00000197386 2.23274865882838 [] [] 3 hSpCas9 negative selection 3517762
3136273 3136296 4 + 26780180 A375 viability (Avana lentiCRISPRv2) GCTTGGAGATGAAGACCCCAGGG HTT ENSG00000197386 -0.454853691490744 [] [] 0 hSpCas9 negative selection 3517763
3105385 3105408 4 - 26780180 A375 viability (Avana lentiCRISPRv2) CAGCTCAGCAAACCTCCACAGGG HTT ENSG00000197386 -1.61315810504208 [] [] -2 hSpCas9 negative selection 3517764
3127264 3127287 4 - 26780180 A375 viability (Avana lentiCRISPRv2) ACTGATCTCATCCTTCACTGAGG HTT ENSG00000197386 -4.55493029330923 [] [] -5 hSpCas9 negative selection 3517765
3121373 3121396 4 - 26780180 A375 viability (Avana lentiCRISPRv2) ACCAGACTCCTCCTTAGCAGCGG HTT ENSG00000197386 -4.20729014068432 [] [] -5 hSpCas9 negative selection 3517766
3173125 3173148 4 - 26780180 A375 viability (Avana lentiCRISPRv2) TTGCCACAACTGTTACCCCGAGG HTT ENSG00000197386 2.24630791244816 [] [] 3 hSpCas9 negative selection 3517767
3127543 3127566 4 + 26780180 A375 viability (Avana lentiGuide) GCTCCCAGACCACCACCGAAGGG HTT ENSG00000197386 -1.69477825149 [] [] -3 hSpCas9 negative selection 3626421
3136273 3136296 4 + 26780180 A375 viability (Avana lentiGuide) GCTTGGAGATGAAGACCCCAGGG HTT ENSG00000197386 2.78193376041236 [] [] 3 hSpCas9 negative selection 3626422
3105385 3105408 4 - 26780180 A375 viability (Avana lentiGuide) CAGCTCAGCAAACCTCCACAGGG HTT ENSG00000197386 -2.18515984682571 [] [] -4 hSpCas9 negative selection 3626423
3127264 3127287 4 - 26780180 A375 viability (Avana lentiGuide) ACTGATCTCATCCTTCACTGAGG HTT ENSG00000197386 0.526862855567406 [] [] 0 hSpCas9 negative selection 3626424
3121373 3121396 4 - 26780180 A375 viability (Avana lentiGuide) ACCAGACTCCTCCTTAGCAGCGG HTT ENSG00000197386 3.85715911246264 [] [] 4 hSpCas9 negative selection 3626425
3173125 3173148 4 - 26780180 A375 viability (Avana lentiGuide) TTGCCACAACTGTTACCCCGAGG HTT ENSG00000197386 3.49994268724758 [] [] 3 hSpCas9 negative selection 3626426
3127543 3127566 4 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCTCCCAGACCACCACCGAAGGG HTT ENSG00000197386 0.008396401395829645 [4] [4,3] 0 hSpCas9 positive selection 3735080
3136273 3136296 4 + 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) GCTTGGAGATGAAGACCCCAGGG HTT ENSG00000197386 0.1069534623074827 [5] [5,5] 2 hSpCas9 positive selection 3735081
3105385 3105408 4 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) CAGCTCAGCAAACCTCCACAGGG HTT ENSG00000197386 -0.14519605933852342 [4] [4,3] -2 hSpCas9 positive selection 3735082
3127264 3127287 4 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ACTGATCTCATCCTTCACTGAGG HTT ENSG00000197386 -0.28055259403553473 [6] [4,4] -4 hSpCas9 positive selection 3735083
3121373 3121396 4 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) ACCAGACTCCTCCTTAGCAGCGG HTT ENSG00000197386 -0.014443011456879923 [5] [5,4] 0 hSpCas9 positive selection 3735084
3173125 3173148 4 - 26780180 A375 resistance to vemurafenib (Avana lentiCRISPRv2) TTGCCACAACTGTTACCCCGAGG HTT ENSG00000197386 0.23760932931396306 [4] [5,5] 6 hSpCas9 positive selection 3735085
3127543 3127566 4 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCTCCCAGACCACCACCGAAGGG HTT ENSG00000197386 0.14673202392057477 [5] [4,5] 3 hSpCas9 positive selection 3843687
3136273 3136296 4 + 26780180 A375 resistance to vemurafenib (Avana lentiGuide) GCTTGGAGATGAAGACCCCAGGG HTT ENSG00000197386 -0.00015021590028990728 [6] [4,5] 0 hSpCas9 positive selection 3843688
3105385 3105408 4 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) CAGCTCAGCAAACCTCCACAGGG HTT ENSG00000197386 0.34456083764457296 [5] [5,6] 8 hSpCas9 positive selection 3843689
3127264 3127287 4 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ACTGATCTCATCCTTCACTGAGG HTT ENSG00000197386 0.2588840048732841 [6] [6,7] 7 hSpCas9 positive selection 3843690
3121373 3121396 4 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) ACCAGACTCCTCCTTAGCAGCGG HTT ENSG00000197386 -0.14099718990658325 [5] [3,4] -2 hSpCas9 positive selection 3843691
3173125 3173148 4 - 26780180 A375 resistance to vemurafenib (Avana lentiGuide) TTGCCACAACTGTTACCCCGAGG HTT ENSG00000197386 0.09221480624884158 [5] [4,5] 2 hSpCas9 positive selection 3843692
3099336 3099359 4 + 26780180 A375 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 1.39602080424759 [] [] 7 hSpCas9 negative selection 3949660
3075075 3075098 4 - 26780180 A375 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 1.50457203320051 [] [] 8 hSpCas9 negative selection 3949661
3099281 3099304 4 - 26780180 A375 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.994427067354233 [] [] 4 hSpCas9 negative selection 3949662
3086987 3087010 4 + 26780180 A375 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 1.04254196305773 [] [] 5 hSpCas9 negative selection 3949663
3074816 3074839 4 + 26780180 A375 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.823662186764297 [] [] 3 hSpCas9 negative selection 3949664
3086969 3086992 4 - 26780180 A375 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 1.18987640634229 [] [] 6 hSpCas9 negative selection 3949665
3099336 3099359 4 + 26780180 HT29 viability (GeCKOv2 library) ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 1.94438986140317 [] [] 9 hSpCas9 negative selection 4057626
3075075 3075098 4 - 26780180 HT29 viability (GeCKOv2 library) CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 0.94111161507398 [] [] 4 hSpCas9 negative selection 4057627
3099281 3099304 4 - 26780180 HT29 viability (GeCKOv2 library) CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 1.01238559539954 [] [] 4 hSpCas9 negative selection 4057628
3086987 3087010 4 + 26780180 HT29 viability (GeCKOv2 library) GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 1.14696835558653 [] [] 5 hSpCas9 negative selection 4057629
3074816 3074839 4 + 26780180 HT29 viability (GeCKOv2 library) GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 1.29759491593392 [] [] 6 hSpCas9 negative selection 4057630
3086969 3086992 4 - 26780180 HT29 viability (GeCKOv2 library) TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.333521815046349 [] [] 0 hSpCas9 negative selection 4057631
3075075 3075098 4 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.11697448203297084 [2] [2,0] -3 hSpCas9 positive selection 4143719
3086987 3087010 4 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 0.1350729032137813 [1] [0,1] 3 hSpCas9 positive selection 4143720
3086969 3086992 4 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiCRISPRv1) TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.5091712896456334 [3] [5,2] 9 hSpCas9 positive selection 4143721
3075075 3075098 4 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 0.6349479200193217 [1] [0,0,4,0] 4 hSpCas9 positive selection 4207741
3086987 3087010 4 + 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 0.432238708751498 [3] [0,3,3,0] 3 hSpCas9 positive selection 4207742
3086969 3086992 4 - 26780180 A375 resistance to vemurafenib (GeCKOv1 lentiGuide) TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.838573509248223 [3] [0,0,0,0] -9 hSpCas9 positive selection 4207743
3075075 3075098 4 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 0.09243851507900289 [3] [2,2] 1 hSpCas9 positive selection 4276098
3099336 3099359 4 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 -0.0034277420628074096 [3] [2,2] 0 hSpCas9 positive selection 4276099
3074816 3074839 4 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.18181501782042875 [1] [1,0] -4 hSpCas9 positive selection 4276100
3086969 3086992 4 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.6217299540776194 [3] [3,5] 9 hSpCas9 positive selection 4340356
3086987 3087010 4 + 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.3259948149905628 [1] [1,0] -6 hSpCas9 positive selection 4340357
3099281 3099304 4 - 26780180 A375 resistance to vemurafenib (GeCKOv2 lentiGuide) CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.22146495682658265 [2] [2,1] 4 hSpCas9 positive selection 4340358
3136289 3136311 4 - 27760321 OCIAML3 viability CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.872340716133372 [800,733] [1035,1179] 8 hSpCas9 negative selection 4408467
3154328 3154350 4 + 27760321 OCIAML3 viability AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.8129019159200117 [373,323] [134,180] -6 hSpCas9 negative selection 4408468
3172351 3172373 4 - 27760321 OCIAML3 viability ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 0.25197109529345585 [227,190] [189,199] 3 hSpCas9 negative selection 4408469
3105365 3105387 4 - 27760321 OCIAML3 viability GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 -0.5873221293600456 [598,417] [206,332] -5 hSpCas9 negative selection 4408470
3115347 3115369 4 - 27760321 OCIAML3 viability GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 0.0986355722769311 [801,623] [519,687] 1 hSpCas9 negative selection 4408471
3136289 3136311 4 - 27760321 OCIAML2 viability CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.8064980270613868 [800,733] [981,1221] 9 hSpCas9 negative selection 4491930
3154328 3154350 4 + 27760321 OCIAML2 viability AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.5785971670417331 [373,323] [210,158] -6 hSpCas9 negative selection 4491931
3172351 3172373 4 - 27760321 OCIAML2 viability ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 0.08856944245913101 [227,190] [169,191] 1 hSpCas9 negative selection 4491932
3105365 3105387 4 - 27760321 OCIAML2 viability GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.33626932132868587 [598,417] [509,517] 4 hSpCas9 negative selection 4491933
3115347 3115369 4 - 27760321 OCIAML2 viability GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -0.9220519831622158 [801,623] [218,411] -7 hSpCas9 negative selection 4491934
3136289 3136311 4 - 27760321 MV411 viability CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 1.0878561381906726 [800,733] [869,1385] 7 hSpCas9 negative selection 4575393
3154328 3154350 4 + 27760321 MV411 viability AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.34324019019785984 [373,323] [25,413] -2 hSpCas9 negative selection 4575394
3172351 3172373 4 - 27760321 MV411 viability ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 0.19289205891574468 [227,190] [156,157] 1 hSpCas9 negative selection 4575395
3105365 3105387 4 - 27760321 MV411 viability GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.21152377289914542 [598,417] [320,478] 1 hSpCas9 negative selection 4575396
3115347 3115369 4 - 27760321 MV411 viability GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -0.3433136015160302 [801,623] [231,572] -2 hSpCas9 negative selection 4575397
3136289 3136311 4 - 27760321 HL60 viability CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.40099642150324444 [800,733] [780,876] 5 hSpCas9 negative selection 4658856
3154328 3154350 4 + 27760321 HL60 viability AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.3575981710071286 [373,323] [119,329] -4 hSpCas9 negative selection 4658857
3172351 3172373 4 - 27760321 HL60 viability ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.5213433071126232 [227,190] [143,91] -5 hSpCas9 negative selection 4658858
3105365 3105387 4 - 27760321 HL60 viability GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 -1.0108886036646159 [598,417] [196,210] -7 hSpCas9 negative selection 4658859
3115347 3115369 4 - 27760321 HL60 viability GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -0.3046156054612112 [801,623] [394,545] -3 hSpCas9 negative selection 4658860
3136289 3136311 4 - 27760321 HT1080 viability CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 -1.6248864836929817 [733,572] [71,97] -5 hSpCas9 negative selection 4742319
3154328 3154350 4 + 27760321 HT1080 viability AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 0.9415848785673537 [323,252] [246,191] 5 hSpCas9 negative selection 4742320
3172351 3172373 4 - 27760321 HT1080 viability ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.1938716941832619 [190,148] [52,65] -1 hSpCas9 negative selection 4742321
3105365 3105387 4 - 27760321 HT1080 viability GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 1.0192323073038523 [417,325] [233,372] 5 hSpCas9 negative selection 4742322
3115347 3115369 4 - 27760321 HT1080 viability GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -0.5064858898630479 [623,486] [129,183] -2 hSpCas9 negative selection 4742323
3136289 3136311 4 - 27760321 HT29 viability after 7 days CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.659064100165392 [733,572] [1643,842,1529] 8 hSpCas9 negative selection 4825782
3154328 3154350 4 + 27760321 HT29 viability after 7 days AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 0.003952037272774267 [323,252] [523,494,125] 0 hSpCas9 negative selection 4825783
3172351 3172373 4 - 27760321 HT29 viability after 7 days ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.6461664065995381 [190,148] [50,115,235] -7 hSpCas9 negative selection 4825784
3105365 3105387 4 - 27760321 HT29 viability after 7 days GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.5909835613247945 [417,325] [625,714,802] 8 hSpCas9 negative selection 4825785
3115347 3115369 4 - 27760321 HT29 viability after 7 days GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 0.36540657991414616 [623,486] [854,1049,846] 5 hSpCas9 negative selection 4825786
3136289 3136311 4 - 27760321 HT29 viability after 25 days CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.8768134567115612 [733,572] [947,1344,1900] 8 hSpCas9 negative selection 4909245
3154328 3154350 4 + 27760321 HT29 viability after 25 days AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.6099632637569516 [323,252] [108,264,287] -5 hSpCas9 negative selection 4909246
3172351 3172373 4 - 27760321 HT29 viability after 25 days ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.32756758555931786 [190,148] [140,212,105] -3 hSpCas9 negative selection 4909247
3105365 3105387 4 - 27760321 HT29 viability after 25 days GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 -0.38719555867841016 [417,325] [146,391,460] -4 hSpCas9 negative selection 4909248
3115347 3115369 4 - 27760321 HT29 viability after 25 days GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -1.1418342939465127 [623,486] [486,127,228] -7 hSpCas9 negative selection 4909249
3136289 3136311 4 - 27760321 HT29 viability after 22 days CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.7864631167658148 [733,572] [1271,1343,1293] 8 hSpCas9 negative selection 4992708
3154328 3154350 4 + 27760321 HT29 viability after 22 days AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.9221114376510052 [323,252] [88,201,239] -6 hSpCas9 negative selection 4992709
3172351 3172373 4 - 27760321 HT29 viability after 22 days ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.4581622658075011 [190,148] [204,128,92] -4 hSpCas9 negative selection 4992710
3105365 3105387 4 - 27760321 HT29 viability after 22 days GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 -0.832134807130283 [417,325] [218,289,215] -6 hSpCas9 negative selection 4992711
3115347 3115369 4 - 27760321 HT29 viability after 22 days GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -1.3112261913080032 [623,486] [457,154,156] -7 hSpCas9 negative selection 4992712
3136289 3136311 4 - 27760321 HT29 viability after 19 days CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 1.0255954033306987 [733,572] [1580,1148,1827] 9 hSpCas9 negative selection 5076171
3154328 3154350 4 + 27760321 HT29 viability after 19 days AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.5452814391109765 [323,252] [179,257,234] -5 hSpCas9 negative selection 5076172
3172351 3172373 4 - 27760321 HT29 viability after 19 days ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 0.5151751449009491 [190,148] [180,330,309] 5 hSpCas9 negative selection 5076173
3105365 3105387 4 - 27760321 HT29 viability after 19 days GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.12733815339648852 [417,325] [392,280,702] 1 hSpCas9 negative selection 5076174
3115347 3115369 4 - 27760321 HT29 viability after 19 days GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -0.781409138087664 [623,486] [262,398,432] -6 hSpCas9 negative selection 5076175
3136289 3136311 4 - 27760321 HT29 viability after 16 days CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.9529411896668561 [733,572] [1300,1226,1711] 9 hSpCas9 negative selection 5159634
3154328 3154350 4 + 27760321 HT29 viability after 16 days AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.11468026127418107 [323,252] [402,229,272] -1 hSpCas9 negative selection 5159635
3172351 3172373 4 - 27760321 HT29 viability after 16 days ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.1273319941928286 [190,148] [106,135,273] -1 hSpCas9 negative selection 5159636
3105365 3105387 4 - 27760321 HT29 viability after 16 days GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.522838804493196 [417,325] [651,707,435] 6 hSpCas9 negative selection 5159637
3115347 3115369 4 - 27760321 HT29 viability after 16 days GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -0.8711474442992219 [623,486] [362,357,299] -6 hSpCas9 negative selection 5159638
3136289 3136311 4 - 27760321 HT29 viability after 13 days CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.742297608008586 [733,572] [1359,1068,1368] 8 hSpCas9 negative selection 5243097
3154328 3154350 4 + 27760321 HT29 viability after 13 days AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 -0.028306633284178317 [323,252] [320,325,336] 0 hSpCas9 negative selection 5243098
3172351 3172373 4 - 27760321 HT29 viability after 13 days ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.42845344849417777 [190,148] [168,199,74] -5 hSpCas9 negative selection 5243099
3105365 3105387 4 - 27760321 HT29 viability after 13 days GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 0.6457699449147208 [417,325] [860,744,433] 8 hSpCas9 negative selection 5243100
3115347 3115369 4 - 27760321 HT29 viability after 13 days GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 0.012875762501860177 [623,486] [740,621,590] 0 hSpCas9 negative selection 5243101
3136289 3136311 4 - 27760321 HT29 viability after 10 days CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.8148250674441518 [733,572] [1702,1080,1509] 9 hSpCas9 negative selection 5326560
3154328 3154350 4 + 27760321 HT29 viability after 10 days AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 0.22266511809734787 [323,252] [264,450,542] 3 hSpCas9 negative selection 5326561
3172351 3172373 4 - 27760321 HT29 viability after 10 days ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 -0.5658268746835091 [190,148] [135,203,92] -6 hSpCas9 negative selection 5326562
3105365 3105387 4 - 27760321 HT29 viability after 10 days GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 1.1051312016734762 [417,325] [1146,829,1014] 9 hSpCas9 negative selection 5326563
3115347 3115369 4 - 27760321 HT29 viability after 10 days GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 0.18762630769880384 [623,486] [980,712,675] 2 hSpCas9 negative selection 5326564
3136289 3136311 4 - 27760321 MOLM13 viability CGGCAACATGTCGCACCCTGGG HTT ENSG00000197386 0.5854276117187871 [800,733] [500,775] 4 hSpCas9 negative selection 5410023
3154328 3154350 4 + 27760321 MOLM13 viability AAGTCCCATCCGACGAAAGGGG HTT ENSG00000197386 0.10447612861631594 [373,323] [336,103] 0 hSpCas9 negative selection 5410024
3172351 3172373 4 - 27760321 MOLM13 viability ATTGGTTCTCGACTAAAGCAGG HTT ENSG00000197386 0.5720202727683481 [227,190] [46,283] 4 hSpCas9 negative selection 5410025
3105365 3105387 4 - 27760321 MOLM13 viability GGCAGCACGCAAACTCCGAGGG HTT ENSG00000197386 -1.6240280346281617 [598,417] [84,97] -7 hSpCas9 negative selection 5410026
3115347 3115369 4 - 27760321 MOLM13 viability GCCGCTGTCCGCCGAATGGTGG HTT ENSG00000197386 -2.0359504282523195 [801,623] [64,124] -8 hSpCas9 negative selection 5410027
3075112 3075135 4 - 27661255 K562 viability GCCTGGGACCCGCCGGGACAGGG HTT ENSG00000197386 -0.16294140988896422 [522,520] [399,348] -5 dCas9-KRAB negative selection 5485896
3075118 3075141 4 - 27661255 K562 viability GCCGTAGCCTGGGACCCGCCGGG HTT ENSG00000197386 -0.048397219230635 [651,584] [536,428] -2 dCas9-KRAB negative selection 5485897
3075075 3075098 4 - 27260156 BXPC3 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 0.19844724503574118 [597] [627,638,909,703] 4 hSpCas9 negative selection 5548558
3099336 3099359 4 + 27260156 BXPC3 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.0873407147758033 [643] [568,629,811,889] 2 hSpCas9 negative selection 5548559
3074816 3074839 4 + 27260156 BXPC3 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.17041636735143095 [149] [131,102,216,274] 4 hSpCas9 negative selection 5548560
3086969 3086992 4 - 27260156 BXPC3 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.017334687739768984 [724] [810,732,692,829] 0 hSpCas9 negative selection 5612816
3086987 3087010 4 + 27260156 BXPC3 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.7034735606680094 [152] [75,87,124,107] -8 hSpCas9 negative selection 5612817
3099281 3099304 4 - 27260156 BXPC3 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.6513182780176321 [200] [337,281,334,369] 9 hSpCas9 negative selection 5612818
3075075 3075098 4 - 27260156 A673 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.07437118782068253 [597] [671,758,653,635] -2 hSpCas9 negative selection 5669809
3099336 3099359 4 + 27260156 A673 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.012660200781249797 [643] [783,634,801,908] 0 hSpCas9 negative selection 5669810
3074816 3074839 4 + 27260156 A673 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.06558087519076916 [149] [294,105,150,217] 1 hSpCas9 negative selection 5669811
3086969 3086992 4 - 27260156 A673 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.04618461788537065 [724] [910,770,961,956] 1 hSpCas9 negative selection 5734067
3086987 3087010 4 + 27260156 A673 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.4493009893569011 [152] [180,107,165,85] -8 hSpCas9 negative selection 5734068
3099281 3099304 4 - 27260156 A673 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.417398873037789 [200] [350,440,265,225] 8 hSpCas9 negative selection 5734069
3075075 3075098 4 - 27260156 A375 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.7572490906674784 [597] [443,517,437,281] -7 hSpCas9 negative selection 5791060
3099336 3099359 4 + 27260156 A375 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.20376894943780155 [643] [947,1025,915,623] 3 hSpCas9 negative selection 5791061
3074816 3074839 4 + 27260156 A375 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.1295986622811831 [149] [108,262,190,209] 1 hSpCas9 negative selection 5791062
3086969 3086992 4 - 27260156 A375 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.3320326782262092 [724] [672,543,823,633] -5 hSpCas9 negative selection 5855318
3086987 3087010 4 + 27260156 A375 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -1.3514943134368689 [152] [79,99,23,78] -9 hSpCas9 negative selection 5855319
3099281 3099304 4 - 27260156 A375 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.8709843107436257 [200] [384,638,220,491] 9 hSpCas9 negative selection 5855320
3075075 3075098 4 - 27260156 COLO741 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.023273435621090577 [597] [796,658,797] 0 hSpCas9 negative selection 5912311
3099336 3099359 4 + 27260156 COLO741 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.028692495294380116 [643] [805,972,741] 0 hSpCas9 negative selection 5912312
3074816 3074839 4 + 27260156 COLO741 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.16619448068296672 [149] [302,231,123] 3 hSpCas9 negative selection 5912313
3086969 3086992 4 - 27260156 COLO741 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.07013356601112952 [724] [1041,909,718] -1 hSpCas9 negative selection 5976569
3086987 3087010 4 + 27260156 COLO741 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.802316563044293 [152] [138,166,37] -9 hSpCas9 negative selection 5976570
3099281 3099304 4 - 27260156 COLO741 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.8633506462783944 [200] [654,486,287] 9 hSpCas9 negative selection 5976571
3075075 3075098 4 - 27260156 CAL120 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.2882378219950221 [597] [640,657,534] -4 hSpCas9 negative selection 6033562
3099336 3099359 4 + 27260156 CAL120 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.24289308669272103 [643] [1275,898,722] 3 hSpCas9 negative selection 6033563
3074816 3074839 4 + 27260156 CAL120 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.04049376665693272 [149] [117,187,227] 0 hSpCas9 negative selection 6033564
3086969 3086992 4 - 27260156 CAL120 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.13801096404813995 [724] [900,778,791] -2 hSpCas9 negative selection 6097820
3086987 3087010 4 + 27260156 CAL120 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.8205104822826021 [152] [85,64,167] -8 hSpCas9 negative selection 6097821
3099281 3099304 4 - 27260156 CAL120 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.8512382796289724 [200] [548,243,572] 9 hSpCas9 negative selection 6097822
3075075 3075098 4 - 27260156 CADOES1 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.11209894920414609 [597] [585,487,498,483] -2 hSpCas9 negative selection 6154813
3099336 3099359 4 + 27260156 CADOES1 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.2799116419532258 [643] [698,585,706,923] 5 hSpCas9 negative selection 6154814
3074816 3074839 4 + 27260156 CADOES1 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.3528893925810328 [149] [303,186,78,140] 6 hSpCas9 negative selection 6154815
3086969 3086992 4 - 27260156 CADOES1 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.15769314979215077 [724] [1016,494,602,897] 2 hSpCas9 negative selection 6219071
3086987 3087010 4 + 27260156 CADOES1 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.38450664703984727 [152] [88,84,127,134] -6 hSpCas9 negative selection 6219072
3099281 3099304 4 - 27260156 CADOES1 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.3921590551265156 [200] [169,281,222,308] 6 hSpCas9 negative selection 6219073
3075075 3075098 4 - 27260156 EWS502 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.6073567116580676 [597] [422,356,413,472] -7 hSpCas9 negative selection 6276064
3099336 3099359 4 + 27260156 EWS502 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.3229473278998749 [643] [723,625,1106,990] 5 hSpCas9 negative selection 6276065
3074816 3074839 4 + 27260156 EWS502 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.07060278342477533 [149] [115,170,190,128] -1 hSpCas9 negative selection 6276066
3086969 3086992 4 - 27260156 EWS502 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.15249132215458844 [724] [837,595,618,692] -3 hSpCas9 negative selection 6340322
3086987 3087010 4 + 27260156 EWS502 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.7096431162030654 [152] [107,51,111,126] -8 hSpCas9 negative selection 6340323
3099281 3099304 4 - 27260156 EWS502 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.45841490645560834 [200] [306,276,191,397] 7 hSpCas9 negative selection 6340324
3075075 3075098 4 - 27260156 EW8 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.16054796109427188 [597] [466,416,323,546] -3 hSpCas9 negative selection 6397315
3099336 3099359 4 + 27260156 EW8 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 -0.12629530674605033 [643] [508,487,440,482] -2 hSpCas9 negative selection 6397316
3074816 3074839 4 + 27260156 EW8 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.3372786810585984 [149] [131,171,108,205] 6 hSpCas9 negative selection 6397317
3086969 3086992 4 - 27260156 EW8 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.015840692056260264 [724] [771,656,527,448] 0 hSpCas9 negative selection 6461573
3086987 3087010 4 + 27260156 EW8 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.7804758889957115 [152] [50,49,65,119] -8 hSpCas9 negative selection 6461574
3099281 3099304 4 - 27260156 EW8 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.2552757456046906 [200] [229,252,191,106] 5 hSpCas9 negative selection 6461575
3075075 3075098 4 - 27260156 CORL105 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.17895279735596895 [597] [790,480,779,455] -3 hSpCas9 negative selection 6518566
3099336 3099359 4 + 27260156 CORL105 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 -0.04212068782470968 [643] [690,735,875,646] -1 hSpCas9 negative selection 6518567
3074816 3074839 4 + 27260156 CORL105 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.0439861136717401 [149] [199,251,81,132] -1 hSpCas9 negative selection 6518568
3086969 3086992 4 - 27260156 CORL105 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.07679573102616843 [724] [810,673,1004,762] -1 hSpCas9 negative selection 6582824
3086987 3087010 4 + 27260156 CORL105 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.5565919201569891 [152] [33,122,154,176] -7 hSpCas9 negative selection 6582825
3099281 3099304 4 - 27260156 CORL105 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.21115901694753192 [200] [215,267,294,311] 4 hSpCas9 negative selection 6582826
3075075 3075098 4 - 27260156 HS294T viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.5283263737036998 [597] [182,134,162,157] -6 hSpCas9 negative selection 6639817
3099336 3099359 4 + 27260156 HS294T viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.7361347439991699 [643] [257,264,870,257] 8 hSpCas9 negative selection 6639818
3074816 3074839 4 + 27260156 HS294T viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.24395223643694397 [149] [49,52,45,45] -3 hSpCas9 negative selection 6639819
3086969 3086992 4 - 27260156 HS294T viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.11463113593222962 [724] [194,244,324,279] -2 hSpCas9 negative selection 6704075
3086987 3087010 4 + 27260156 HS294T viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -1.5870443848363858 [152] [15,17,20,24] -9 hSpCas9 negative selection 6704076
3099281 3099304 4 - 27260156 HS294T viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.09645737930140652 [200] [90,52,71,122] 1 hSpCas9 negative selection 6704077
3075075 3075098 4 - 27260156 HCC44 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.6085773039394624 [597] [466,351,632,368] -7 hSpCas9 negative selection 6761068
3099336 3099359 4 + 27260156 HCC44 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.4164375727523496 [643] [999,897,902,1076] 7 hSpCas9 negative selection 6761069
3074816 3074839 4 + 27260156 HCC44 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.18562864047093974 [149] [334,32,376,95] 3 hSpCas9 negative selection 6761070
3086969 3086992 4 - 27260156 HCC44 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.18618321815592348 [724] [752,583,753,810] -3 hSpCas9 negative selection 6825326
3086987 3087010 4 + 27260156 HCC44 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.223471486020413 [152] [99,274,120,70] -4 hSpCas9 negative selection 6825327
3099281 3099304 4 - 27260156 HCC44 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.19995204416237677 [200] [195,342,346,156] 3 hSpCas9 negative selection 6825328
3075075 3075098 4 - 27260156 G402 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.5980715289068779 [597] [798,629,202,354] -6 hSpCas9 negative selection 6882319
3099336 3099359 4 + 27260156 G402 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.17052914707291522 [643] [912,684,922,999] 2 hSpCas9 negative selection 6882320
3074816 3074839 4 + 27260156 G402 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.14966301672541493 [149] [428,204,131,83] 2 hSpCas9 negative selection 6882321
3086969 3086992 4 - 27260156 G402 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.5839947294867875 [724] [679,556,427,698] -6 hSpCas9 negative selection 6946577
3086987 3087010 4 + 27260156 G402 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.3024920486219207 [152] [291,113,127,91] -4 hSpCas9 negative selection 6946578
3099281 3099304 4 - 27260156 G402 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 1.0481290024946863 [200] [611,301,377,726] 9 hSpCas9 negative selection 6946579
3075075 3075098 4 - 27260156 L33 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 0.12131640316989317 [597] [625,238,386,775] 2 hSpCas9 negative selection 7003570
3099336 3099359 4 + 27260156 L33 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 -0.08529098840051974 [643] [694,227,367,588] -2 hSpCas9 negative selection 7003571
3074816 3074839 4 + 27260156 L33 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.4476361885085056 [149] [87,66,53,102] -8 hSpCas9 negative selection 7003572
3086969 3086992 4 - 27260156 L33 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.1956734725749013 [724] [664,448,424,886] 4 hSpCas9 negative selection 7067828
3086987 3087010 4 + 27260156 L33 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.3513196336912987 [152] [117,40,69,149] -7 hSpCas9 negative selection 7067829
3099281 3099304 4 - 27260156 L33 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.38670932873944086 [200] [288,95,188,226] 7 hSpCas9 negative selection 7067830
3075075 3075098 4 - 27260156 K562 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.6729233727769642 [597] [333,628,184,211] -7 hSpCas9 negative selection 7124821
3099336 3099359 4 + 27260156 K562 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.16433320194328815 [643] [775,923,526,387] 2 hSpCas9 negative selection 7124822
3074816 3074839 4 + 27260156 K562 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.8217809765039211 [149] [166,122,198,417] 9 hSpCas9 negative selection 7124823
3086969 3086992 4 - 27260156 K562 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.5220104183565495 [724] [575,1032,1335,744] 6 hSpCas9 negative selection 7189079
3086987 3087010 4 + 27260156 K562 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.3734098842458278 [152] [19,37,62,267] -4 hSpCas9 negative selection 7189080
3099281 3099304 4 - 27260156 K562 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.7163066705849864 [200] [359,356,293,181] 8 hSpCas9 negative selection 7189081
3075075 3075098 4 - 27260156 HT29 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.1967336472913058 [597] [749,588,613,589] -4 hSpCas9 negative selection 7246072
3099336 3099359 4 + 27260156 HT29 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.0808220303378665 [643] [1124,866,619,731] 1 hSpCas9 negative selection 7246073
3074816 3074839 4 + 27260156 HT29 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.04967381994283726 [149] [202,226,194,94] -1 hSpCas9 negative selection 7246074
3086969 3086992 4 - 27260156 HT29 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.01383480232960177 [724] [898,986,961,673] 0 hSpCas9 negative selection 7310330
3086987 3087010 4 + 27260156 HT29 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.8362135846290484 [152] [109,123,123,64] -8 hSpCas9 negative selection 7310331
3099281 3099304 4 - 27260156 HT29 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.47995823633970924 [200] [330,374,245,402] 8 hSpCas9 negative selection 7310332
3075075 3075098 4 - 27260156 MHHES1 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.2128646431415436 [597] [551,660,722,418] -4 hSpCas9 negative selection 7367323
3099336 3099359 4 + 27260156 MHHES1 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 -0.17444678680131465 [643] [721,858,576,469] -3 hSpCas9 negative selection 7367324
3074816 3074839 4 + 27260156 MHHES1 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.11199609253321374 [149] [144,182,199,106] -2 hSpCas9 negative selection 7367325
3086969 3086992 4 - 27260156 MHHES1 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.2922252215190054 [724] [717,726,782,480] -5 hSpCas9 negative selection 7431581
3086987 3087010 4 + 27260156 MHHES1 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.24859953562194992 [152] [281,63,104,135] -5 hSpCas9 negative selection 7431582
3099281 3099304 4 - 27260156 MHHES1 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.27274493246779363 [200] [467,214,297,152] 5 hSpCas9 negative selection 7431583
3075075 3075098 4 - 27260156 MEWO viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.5012901755546446 [597] [437,382,372] -8 hSpCas9 negative selection 7488574
3099336 3099359 4 + 27260156 MEWO viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.01975175111188815 [643] [642,512,682] 0 hSpCas9 negative selection 7488575
3074816 3074839 4 + 27260156 MEWO viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.17321825726281737 [149] [168,118,93] -4 hSpCas9 negative selection 7488576
3086969 3086992 4 - 27260156 MEWO viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.16981874697231147 [724] [888,818,604] 4 hSpCas9 negative selection 7552832
3086987 3087010 4 + 27260156 MEWO viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -1.1768543705683203 [152] [68,68,52] -9 hSpCas9 negative selection 7552833
3099281 3099304 4 - 27260156 MEWO viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.2759338299433658 [200] [201,232,242] 6 hSpCas9 negative selection 7552834
3075075 3075098 4 - 27260156 LNCAPCLONEFGC viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.4477155598165026 [597] [323,344,603,350] -6 hSpCas9 negative selection 7609825
3099336 3099359 4 + 27260156 LNCAPCLONEFGC viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.07423416421427842 [643] [603,582,650,625] 1 hSpCas9 negative selection 7609826
3074816 3074839 4 + 27260156 LNCAPCLONEFGC viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.5077421554821788 [149] [66,141,63,101] -7 hSpCas9 negative selection 7609827
3086969 3086992 4 - 27260156 LNCAPCLONEFGC viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.2544002856749766 [724] [493,537,618,562] -4 hSpCas9 negative selection 7674083
3086987 3087010 4 + 27260156 LNCAPCLONEFGC viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.49368137955118097 [152] [125,77,74,111] -6 hSpCas9 negative selection 7674084
3099281 3099304 4 - 27260156 LNCAPCLONEFGC viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.8543978732008934 [200] [381,164,521,285] 9 hSpCas9 negative selection 7674085
3075075 3075098 4 - 27260156 PANC0327 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.2591985690221532 [597] [418,570,484,281] -4 hSpCas9 negative selection 7731076
3099336 3099359 4 + 27260156 PANC0327 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.3734833103131032 [643] [1133,674,684,510] 5 hSpCas9 negative selection 7731077
3074816 3074839 4 + 27260156 PANC0327 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.3885308016522184 [149] [80,143,107,66] -5 hSpCas9 negative selection 7731078
3086969 3086992 4 - 27260156 PANC0327 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.08897136757088253 [724] [726,546,1134,352] 1 hSpCas9 negative selection 7795334
3086987 3087010 4 + 27260156 PANC0327 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.12232514315808762 [152] [116,145,103,128] -2 hSpCas9 negative selection 7795335
3099281 3099304 4 - 27260156 PANC0327 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.4235383896562511 [200] [347,207,312,101] 6 hSpCas9 negative selection 7795336
3075075 3075098 4 - 27260156 NCIH2009 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.4553730261445674 [597] [694,605,542] -5 hSpCas9 negative selection 7852327
3099336 3099359 4 + 27260156 NCIH2009 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.2913378002779924 [643] [1221,900,1205] 4 hSpCas9 negative selection 7852328
3074816 3074839 4 + 27260156 NCIH2009 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.006245461811316577 [149] [280,156,207] 0 hSpCas9 negative selection 7852329
3086969 3086992 4 - 27260156 NCIH2009 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.1201825122030511 [724] [993,799,1014] -2 hSpCas9 negative selection 7916585
3086987 3087010 4 + 27260156 NCIH2009 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.7501851990566191 [152] [133,94,153] -7 hSpCas9 negative selection 7916586
3099281 3099304 4 - 27260156 NCIH2009 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 -0.074169393147135 [200] [290,189,324] -1 hSpCas9 negative selection 7916587
3075075 3075098 4 - 27260156 NCIH1373 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.40889569878666104 [597] [632,428,340,171] -4 hSpCas9 negative selection 7973578
3099336 3099359 4 + 27260156 NCIH1373 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.1756949991908906 [643] [1758,321,805,145] 1 hSpCas9 negative selection 7973579
3074816 3074839 4 + 27260156 NCIH1373 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 2.093470447215314 [149] [2376,381,177,53] 9 hSpCas9 negative selection 7973580
3086969 3086992 4 - 27260156 NCIH1373 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.3273100736383532 [724] [962,1166,602,352] 3 hSpCas9 negative selection 8037836
3086987 3087010 4 + 27260156 NCIH1373 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.9781960549459023 [152] [28,204,33,14] -7 hSpCas9 negative selection 8037837
3099281 3099304 4 - 27260156 NCIH1373 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.7501892715724527 [200] [244,257,263,200] 7 hSpCas9 negative selection 8037838
3075075 3075098 4 - 27260156 PATU8902 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -1.374505977758618 [597] [365,164,285,493] -8 hSpCas9 negative selection 8094829
3099336 3099359 4 + 27260156 PATU8902 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.054472019227634005 [643] [1260,873,761,850] 0 hSpCas9 negative selection 8094830
3074816 3074839 4 + 27260156 PATU8902 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 -0.1183519013754819 [149] [174,109,56,497] -1 hSpCas9 negative selection 8094831
3086969 3086992 4 - 27260156 PATU8902 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 -0.4915350071151397 [724] [501,1162,427,871] -5 hSpCas9 negative selection 8159087
3086987 3087010 4 + 27260156 PATU8902 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.9479204947770079 [152] [208,170,49,13] -7 hSpCas9 negative selection 8159088
3099281 3099304 4 - 27260156 PATU8902 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.7087747810930431 [200] [383,715,252,537] 7 hSpCas9 negative selection 8159089
3075075 3075098 4 - 27260156 PANC1 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 -0.2610444889844594 [597] [415,508,458,352] -4 hSpCas9 negative selection 8216080
3099336 3099359 4 + 27260156 PANC1 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.40129942297816124 [643] [626,1300,636,501] 6 hSpCas9 negative selection 8216081
3074816 3074839 4 + 27260156 PANC1 viability GGAGACCGCCATGGCGACCCTGG HTT ENSG00000197386 0.27528579205115555 [149] [84,269,214,87] 4 hSpCas9 negative selection 8216082
3086969 3086992 4 - 27260156 PANC1 viability TTGTCAGACAATGATTCACACGG HTT ENSG00000197386 0.07528150967417557 [724] [624,693,688,619] 1 hSpCas9 negative selection 8280338
3086987 3087010 4 + 27260156 PANC1 viability GACAATATGTGAAAACATAGTGG HTT ENSG00000197386 -0.539316180110496 [152] [67,124,138,43] -7 hSpCas9 negative selection 8280339
3099281 3099304 4 - 27260156 PANC1 viability CCCAGAAGTTTCTGAAATTCTGG HTT ENSG00000197386 0.5477709536794766 [200] [437,235,107,219] 8 hSpCas9 negative selection 8280340
3075075 3075098 4 - 27260156 PANC0813 viability CAAACTCACGGTCGGTGCAGCGG HTT ENSG00000197386 0.2459384913656011 [597] [916,888,875,665] 4 hSpCas9 negative selection 8337331
3099336 3099359 4 + 27260156 PANC0813 viability ATGACGCAGAGTCAGATGTCAGG HTT ENSG00000197386 0.29201861551094777 [643] [1156,1086,678,806] 5 hSpCas9 negative selection 8337332
3074816 3074839 4 + 27260156 PANC0813 viability