Crispr

Gene Info

• Species:Human (Homo sapiens)
• GeneID:54718
• Symbol:BTN2A3P
• Description:butyrophilin subfamily 2 member A3, pseudogene

DataSource: http://genomecrispr.dkfz.de/#!/results/BTN2A3P

Export (tab separated) Export to Excel

Start	The end	chr	strand	pubmed	cellline	condition	sequence	symbol	ensg	log2fc	rc_initial	rc_final	effect	cas	screentype	index
26424071	26424094	6	+	25494202	A375	resistance to PLX-4720 (puromycin)	CAGGCGTGAGCCACTGCACCTAG	BTN2A3P	ENSG00000124549	0.9550246130222104	[38,14]	[18,2]	4	dCas9-VP64	positive selection	2414033
26424071	26424094	6	+	25494202	A375	resistance to PLX-4720 (zeocin)	CAGGCGTGAGCCACTGCACCTAG	BTN2A3P	ENSG00000124549	-0.28279012529460834	[51,110]	[30,11]	-3	dCas9-VP64	positive selection	2509288