| Start | The end | chr | strand | pubmed | cellline | condition | sequence | symbol | ensg | log2fc | rc_initial | rc_final | effect | cas | screentype | index | 106457450 | 106457473 | 14 | + | 25494202 | A375 | resistance to PLX-4720 (puromycin) | CAGGCACCTGCCACCACGCCCAG | IGHG1 | ENSG00000211896 | 3.5563442726279137 | [263,282] | [1245,134] | 9 | dCas9-VP64 | positive selection | 2389746 | 106457450 | 106457473 | 14 | + | 25494202 | A375 | resistance to PLX-4720 (zeocin) | CAGGCACCTGCCACCACGCCCAG | IGHG1 | ENSG00000211896 | 0.46315742416717276 | [258,245] | [121,105] | 3 | dCas9-VP64 | positive selection | 2485001 |
|---|