Crispr

Gene Info

• Species:Human (Homo sapiens)
• GeneID:54441
• Symbol:STAG3L1
• Description:stromal antigen 3-like 1 (pseudogene)

DataSource: http://genomecrispr.dkfz.de/#!/results/STAG3L1

Export (tab separated) Export to Excel

Start	The end	chr	strand	pubmed	cellline	condition	sequence	symbol	ensg	log2fc	rc_initial	rc_final	effect	cas	screentype	index
75363320	75363343	7	+	25494202	A375	resistance to PLX-4720 (puromycin)	TGAGGCAGGCAGATCACTTGAGG	STAG3L1	ENSG00000205583	3.967069992462526	[18,88]	[302,66]	9	dCas9-VP64	positive selection	2403950
75368292	75368315	7	+	25494202	A375	resistance to PLX-4720 (puromycin)	CATGCCACTGCACTCCAGCCTAG	STAG3L1	ENSG00000205583	0.07732275682136047	[9,85]	[6,14]	0	dCas9-VP64	positive selection	2406709
75387021	75387044	7	-	25494202	A375	resistance to PLX-4720 (puromycin)	GCTACTCGGGAGACTGAGGCAAG	STAG3L1	ENSG00000205583	-0.7498462491276636	[113,13]	[10,3]	-4	dCas9-VP64	positive selection	2408561
75363320	75363343	7	+	25494202	A375	resistance to PLX-4720 (zeocin)	TGAGGCAGGCAGATCACTTGAGG	STAG3L1	ENSG00000205583	0.25134554703064405	[383,209]	[122,108]	2	dCas9-VP64	positive selection	2499205
75368292	75368315	7	+	25494202	A375	resistance to PLX-4720 (zeocin)	CATGCCACTGCACTCCAGCCTAG	STAG3L1	ENSG00000205583	-0.2649826808475564	[463,106]	[139,20]	-3	dCas9-VP64	positive selection	2501964
75387021	75387044	7	-	25494202	A375	resistance to PLX-4720 (zeocin)	GCTACTCGGGAGACTGAGGCAAG	STAG3L1	ENSG00000205583	-1.0734520873599889	[20,56]	[6,3]	-8	dCas9-VP64	positive selection	2503816